Incidental Mutation 'R7729:Adgrb2'
ID595692
Institutional Source Beutler Lab
Gene Symbol Adgrb2
Ensembl Gene ENSMUSG00000028782
Gene Nameadhesion G protein-coupled receptor B2
SynonymsBai2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7729 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location129984870-130022633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129992124 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 19 (T19M)
Ref Sequence ENSEMBL: ENSMUSP00000030571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030571] [ENSMUST00000097868] [ENSMUST00000106015] [ENSMUST00000106017] [ENSMUST00000106018] [ENSMUST00000120204] [ENSMUST00000121049]
Predicted Effect probably benign
Transcript: ENSMUST00000030571
AA Change: T19M

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030571
Gene: ENSMUSG00000028782
AA Change: T19M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:GAIN 600 842 1.6e-41 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1192 1.7e-67 PFAM
low complexity region 1357 1371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097868
AA Change: T19M

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095480
Gene: ENSMUSG00000028782
AA Change: T19M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 1.2e-54 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1159 2.6e-69 PFAM
low complexity region 1324 1338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106015
AA Change: T19M

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101636
Gene: ENSMUSG00000028782
AA Change: T19M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 6.4e-55 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1192 4.1e-68 PFAM
low complexity region 1357 1371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106017
AA Change: T19M

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101638
Gene: ENSMUSG00000028782
AA Change: T19M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 6.3e-55 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1180 4.6e-68 PFAM
low complexity region 1345 1359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106018
AA Change: T19M

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101639
Gene: ENSMUSG00000028782
AA Change: T19M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 1.86e-13 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 1.1e-54 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1104 2.4e-69 PFAM
low complexity region 1269 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120204
AA Change: T19M

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112524
Gene: ENSMUSG00000028782
AA Change: T19M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 8.2e-55 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1104 9.6e-70 PFAM
low complexity region 1269 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121049
AA Change: T19M

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112869
Gene: ENSMUSG00000028782
AA Change: T19M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 1.86e-13 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 6.1e-55 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1137 3.8e-68 PFAM
low complexity region 1302 1316 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a a seven-span transmembrane protein that is thought to be a member of the secretin receptor family. The encoded protein is a brain-specific inhibitor of angiogenesis. The mature peptide may be further cleaved into additional products (PMID:20367554). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene show a lessening of depression like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,623 M794I not run Het
1810024B03Rik T G 2: 127,186,790 D163A possibly damaging Het
Abce1 A T 8: 79,687,908 I454N probably damaging Het
Acaca A G 11: 84,371,513 I1980M probably damaging Het
Agmo T A 12: 37,414,975 S417T probably benign Het
Akap8l T C 17: 32,333,094 E403G probably damaging Het
Art5 C T 7: 102,098,504 A23T possibly damaging Het
Atg9a T C 1: 75,184,560 T681A probably benign Het
Atp11b A G 3: 35,778,107 Q37R probably damaging Het
Atp2a2 T C 5: 122,491,766 E80G probably benign Het
AW551984 G A 9: 39,599,775 P172L possibly damaging Het
Bace1 C T 9: 45,858,445 R296C probably damaging Het
Ccser1 T A 6: 61,311,856 H334Q probably benign Het
Chtf18 C T 17: 25,723,517 R449H probably damaging Het
Cit A G 5: 115,984,822 H1384R possibly damaging Het
Cltc A G 11: 86,721,648 I524T probably benign Het
Dctn1 T A 6: 83,183,060 I94N probably damaging Het
Ddx58 T A 4: 40,206,034 I853F possibly damaging Het
Dnhd1 A T 7: 105,705,265 D3078V probably damaging Het
Dock7 G A 4: 99,055,446 P520S Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Eprs T A 1: 185,413,169 Y1130N probably damaging Het
Fcgrt T C 7: 45,095,373 T224A probably damaging Het
Flt1 T A 5: 147,700,367 T39S probably benign Het
Fxyd1 T C 7: 31,053,471 Y33C probably damaging Het
Gab2 T A 7: 97,301,426 V442E probably damaging Het
Ganab A G 19: 8,914,712 D800G probably benign Het
Gata4 C A 14: 63,240,737 A138S probably benign Het
Golga4 A G 9: 118,556,063 H751R possibly damaging Het
Hist1h1t A G 13: 23,696,472 R203G possibly damaging Het
Htra4 A G 8: 25,037,077 V234A possibly damaging Het
Igkv4-74 A T 6: 69,184,970 Y72N probably damaging Het
Iqsec3 T C 6: 121,383,981 K973E probably damaging Het
Khdc1b C A 1: 21,384,841 T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Lrba T A 3: 86,318,167 V666E probably damaging Het
Mettl25 T A 10: 105,766,010 Y528F probably benign Het
Mms19 A T 19: 41,952,465 Y619* probably null Het
Nlrp12 A C 7: 3,228,388 probably null Het
Nol10 C T 12: 17,424,675 L623F possibly damaging Het
Oas1g A G 5: 120,886,000 F82S probably damaging Het
Olfr1537 G A 9: 39,238,250 P58L probably benign Het
Olfr195 C T 16: 59,149,207 A119V probably damaging Het
Olfr335-ps T G 2: 36,301,760 S74A probably benign Het
Oxr1 G A 15: 41,823,467 E582K probably damaging Het
Pdia3 A G 2: 121,432,357 D268G possibly damaging Het
Pramef12 T C 4: 144,392,864 S378G probably damaging Het
Rcor3 A G 1: 192,101,778 Y387H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Rsl1 T C 13: 67,182,220 L244P possibly damaging Het
Scn5a G T 9: 119,495,540 N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 A24V probably benign Het
Slc22a8 A G 19: 8,593,959 Y18C possibly damaging Het
Slc35d1 C T 4: 103,214,847 R7H probably damaging Het
Slco6d1 A T 1: 98,497,523 T599S probably damaging Het
St18 T A 1: 6,802,537 H165Q probably benign Het
Sub1 C T 15: 11,986,503 R86K probably damaging Het
Tectb G A 19: 55,192,672 V148M Het
Tgfb2 C A 1: 186,630,757 G290V possibly damaging Het
Tgm7 T C 2: 121,093,710 H577R probably benign Het
Tle2 T C 10: 81,587,147 S460P probably damaging Het
Tmem221 C A 8: 71,558,802 R3L possibly damaging Het
Tnfrsf19 C A 14: 60,974,734 V156L possibly damaging Het
Trav6-5 A G 14: 53,491,507 K75E probably benign Het
Trip10 G A 17: 57,262,442 G488S probably damaging Het
Usp34 A C 11: 23,449,268 K2419T Het
Vps13d T C 4: 145,075,052 Q3532R Het
Vps4a A T 8: 107,040,897 I163L probably damaging Het
Wrn T C 8: 33,324,426 H330R probably benign Het
Xpr1 T C 1: 155,312,872 I341V probably benign Het
Zfyve9 T C 4: 108,691,776 E105G probably benign Het
Other mutations in Adgrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Adgrb2 APN 4 130018805 missense probably damaging 1.00
IGL00425:Adgrb2 APN 4 130019072 missense probably benign 0.09
IGL00490:Adgrb2 APN 4 130011872 missense possibly damaging 0.82
IGL00928:Adgrb2 APN 4 129992303 missense probably benign
IGL01353:Adgrb2 APN 4 130012300 missense probably damaging 1.00
IGL01521:Adgrb2 APN 4 129992292 missense probably damaging 0.98
IGL01590:Adgrb2 APN 4 130013813 splice site probably benign
IGL01813:Adgrb2 APN 4 130012566 missense probably benign 0.00
IGL01831:Adgrb2 APN 4 130009394 missense probably damaging 1.00
IGL01939:Adgrb2 APN 4 129992132 missense probably damaging 0.99
IGL01960:Adgrb2 APN 4 130012384 splice site probably benign
IGL01993:Adgrb2 APN 4 130018842 missense possibly damaging 0.94
IGL02646:Adgrb2 APN 4 130019282 critical splice donor site probably null
IGL02655:Adgrb2 APN 4 129992179 nonsense probably null
IGL02695:Adgrb2 APN 4 130018832 missense probably damaging 1.00
IGL02998:Adgrb2 APN 4 130019069 missense probably benign 0.15
IGL03372:Adgrb2 APN 4 130017569 missense probably benign 0.42
R0098:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0206:Adgrb2 UTSW 4 129992559 missense probably damaging 1.00
R0311:Adgrb2 UTSW 4 130017129 missense probably damaging 1.00
R0380:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0382:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0492:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0544:Adgrb2 UTSW 4 130017542 missense probably damaging 0.98
R0965:Adgrb2 UTSW 4 129992416 small deletion probably benign
R1458:Adgrb2 UTSW 4 130014591 missense possibly damaging 0.48
R1601:Adgrb2 UTSW 4 129992837 missense probably benign 0.43
R1711:Adgrb2 UTSW 4 129992624 missense probably damaging 1.00
R1758:Adgrb2 UTSW 4 130011875 missense probably damaging 1.00
R1783:Adgrb2 UTSW 4 130009305 missense possibly damaging 0.61
R1827:Adgrb2 UTSW 4 130012557 missense probably damaging 1.00
R1838:Adgrb2 UTSW 4 130010231 missense probably benign 0.00
R1881:Adgrb2 UTSW 4 130010285 missense probably damaging 1.00
R1888:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R1888:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R1894:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R2275:Adgrb2 UTSW 4 130006854 missense probably damaging 1.00
R2926:Adgrb2 UTSW 4 130008344 missense probably damaging 1.00
R4472:Adgrb2 UTSW 4 130008353 missense probably benign 0.12
R4490:Adgrb2 UTSW 4 130012328 missense possibly damaging 0.91
R4499:Adgrb2 UTSW 4 129992661 missense probably damaging 0.99
R4758:Adgrb2 UTSW 4 130009350 missense probably damaging 1.00
R4900:Adgrb2 UTSW 4 130013875 missense probably damaging 1.00
R4904:Adgrb2 UTSW 4 130012539 missense possibly damaging 0.50
R4922:Adgrb2 UTSW 4 130007852 missense probably damaging 1.00
R5330:Adgrb2 UTSW 4 130022202 missense possibly damaging 0.92
R5331:Adgrb2 UTSW 4 130022202 missense possibly damaging 0.92
R5550:Adgrb2 UTSW 4 130014934 critical splice acceptor site probably null
R5995:Adgrb2 UTSW 4 130017103 missense probably damaging 1.00
R6047:Adgrb2 UTSW 4 130018705 missense probably damaging 1.00
R6534:Adgrb2 UTSW 4 130022219 missense probably damaging 0.98
R6565:Adgrb2 UTSW 4 130019276 missense probably damaging 1.00
R6813:Adgrb2 UTSW 4 130009491 missense probably damaging 1.00
R6963:Adgrb2 UTSW 4 130014362 frame shift probably null
R6966:Adgrb2 UTSW 4 130014362 frame shift probably null
R7197:Adgrb2 UTSW 4 130009522 missense probably damaging 1.00
R7409:Adgrb2 UTSW 4 130019069 missense probably benign 0.15
R7451:Adgrb2 UTSW 4 130014557 missense probably damaging 1.00
R7453:Adgrb2 UTSW 4 130014637 critical splice donor site probably null
R7461:Adgrb2 UTSW 4 130021213 critical splice acceptor site probably benign
R7511:Adgrb2 UTSW 4 130022111 missense probably benign
R7613:Adgrb2 UTSW 4 130021213 critical splice acceptor site probably benign
R7818:Adgrb2 UTSW 4 130014560 missense probably damaging 0.98
R7818:Adgrb2 UTSW 4 130014969 missense possibly damaging 0.70
R8033:Adgrb2 UTSW 4 130019012 missense probably benign
R8039:Adgrb2 UTSW 4 130022268 missense probably damaging 0.99
RF020:Adgrb2 UTSW 4 130010084 missense probably damaging 1.00
Z1176:Adgrb2 UTSW 4 130017563 missense probably damaging 1.00
Z1177:Adgrb2 UTSW 4 130011826 missense probably damaging 0.99
Z1177:Adgrb2 UTSW 4 130019119 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGATACCATGAGATAGCTCCAG -3'
(R):5'- GCAAAGTGTGTGCAAACCTG -3'

Sequencing Primer
(F):5'- ATCTTCCTGGTGTAAGGTCACAGAC -3'
(R):5'- TGCTCCTGCCGGTTGAAG -3'
Posted On2019-11-12