Incidental Mutation 'R7729:Ccser1'
ID 595699
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Name coiled-coil serine rich 1
Synonyms 6230405M12Rik, Fam190a, C130092O11Rik
MMRRC Submission 045785-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R7729 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 61157308-62359849 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 61288840 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 334 (H334Q)
Ref Sequence ENSEMBL: ENSMUSP00000040251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000126214]
AlphaFold Q8C0C4
Predicted Effect probably benign
Transcript: ENSMUST00000045522
AA Change: H334Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: H334Q

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126214
AA Change: H334Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: H334Q

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T G 2: 127,028,710 (GRCm39) D163A possibly damaging Het
Abce1 A T 8: 80,414,537 (GRCm39) I454N probably damaging Het
Acaca A G 11: 84,262,339 (GRCm39) I1980M probably damaging Het
Adgrb2 C T 4: 129,885,917 (GRCm39) T19M probably benign Het
Agmo T A 12: 37,464,974 (GRCm39) S417T probably benign Het
Akap8l T C 17: 32,552,068 (GRCm39) E403G probably damaging Het
Art5 C T 7: 101,747,711 (GRCm39) A23T possibly damaging Het
Atg9a T C 1: 75,161,204 (GRCm39) T681A probably benign Het
Atp11b A G 3: 35,832,256 (GRCm39) Q37R probably damaging Het
Atp2a2 T C 5: 122,629,829 (GRCm39) E80G probably benign Het
AW551984 G A 9: 39,511,071 (GRCm39) P172L possibly damaging Het
Bace1 C T 9: 45,769,743 (GRCm39) R296C probably damaging Het
Chtf18 C T 17: 25,942,491 (GRCm39) R449H probably damaging Het
Cit A G 5: 116,122,881 (GRCm39) H1384R possibly damaging Het
Cltc A G 11: 86,612,474 (GRCm39) I524T probably benign Het
Dctn1 T A 6: 83,160,042 (GRCm39) I94N probably damaging Het
Dnhd1 A T 7: 105,354,472 (GRCm39) D3078V probably damaging Het
Dock7 G A 4: 98,943,683 (GRCm39) P520S Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Eprs1 T A 1: 185,145,366 (GRCm39) Y1130N probably damaging Het
Fcgrt T C 7: 44,744,797 (GRCm39) T224A probably damaging Het
Flt1 T A 5: 147,637,177 (GRCm39) T39S probably benign Het
Fxyd1 T C 7: 30,752,896 (GRCm39) Y33C probably damaging Het
Gab2 T A 7: 96,950,633 (GRCm39) V442E probably damaging Het
Ganab A G 19: 8,892,076 (GRCm39) D800G probably benign Het
Gata4 C A 14: 63,478,186 (GRCm39) A138S probably benign Het
Golga4 A G 9: 118,385,131 (GRCm39) H751R possibly damaging Het
H1f6 A G 13: 23,880,455 (GRCm39) R203G possibly damaging Het
Htra4 A G 8: 25,527,093 (GRCm39) V234A possibly damaging Het
Igkv4-74 A T 6: 69,161,954 (GRCm39) Y72N probably damaging Het
Iqsec3 T C 6: 121,360,940 (GRCm39) K973E probably damaging Het
Khdc1b C A 1: 21,455,065 (GRCm39) T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 141,850,333 (GRCm39) probably benign Het
Kyat3 A G 3: 142,432,066 (GRCm39) probably null Het
Lrba T A 3: 86,225,474 (GRCm39) V666E probably damaging Het
Mettl25 T A 10: 105,601,871 (GRCm39) Y528F probably benign Het
Mms19 A T 19: 41,940,904 (GRCm39) Y619* probably null Het
Nlrp12 A C 7: 3,277,020 (GRCm39) probably null Het
Nol10 C T 12: 17,474,676 (GRCm39) L623F possibly damaging Het
Oas1g A G 5: 121,024,063 (GRCm39) F82S probably damaging Het
Or1j8 T G 2: 36,191,772 (GRCm39) S74A probably benign Het
Or5k3 C T 16: 58,969,570 (GRCm39) A119V probably damaging Het
Or8g18 G A 9: 39,149,546 (GRCm39) P58L probably benign Het
Oxr1 G A 15: 41,686,863 (GRCm39) E582K probably damaging Het
Pdia3 A G 2: 121,262,838 (GRCm39) D268G possibly damaging Het
Pramel13 T C 4: 144,119,434 (GRCm39) S378G probably damaging Het
Rcor3 A G 1: 191,786,078 (GRCm39) Y387H probably damaging Het
Rigi T A 4: 40,206,034 (GRCm39) I853F possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,118 (GRCm39) probably benign Het
Rsl1 T C 13: 67,330,284 (GRCm39) L244P possibly damaging Het
Scn5a G T 9: 119,324,606 (GRCm39) N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 (GRCm39) A24V probably benign Het
Slc22a8 A G 19: 8,571,323 (GRCm39) Y18C possibly damaging Het
Slc35d1 C T 4: 103,072,044 (GRCm39) R7H probably damaging Het
Slco6d1 A T 1: 98,425,248 (GRCm39) T599S probably damaging Het
Spata31d1e C T 13: 59,889,437 (GRCm39) M794I not run Het
St18 T A 1: 6,872,761 (GRCm39) H165Q probably benign Het
Sub1 C T 15: 11,986,589 (GRCm39) R86K probably damaging Het
Tectb G A 19: 55,181,104 (GRCm39) V148M Het
Tgfb2 C A 1: 186,362,954 (GRCm39) G290V possibly damaging Het
Tgm7 T C 2: 120,924,191 (GRCm39) H577R probably benign Het
Tle2 T C 10: 81,422,981 (GRCm39) S460P probably damaging Het
Tmem221 C A 8: 72,011,446 (GRCm39) R3L possibly damaging Het
Tnfrsf19 C A 14: 61,212,183 (GRCm39) V156L possibly damaging Het
Trav6-5 A G 14: 53,728,964 (GRCm39) K75E probably benign Het
Trip10 G A 17: 57,569,442 (GRCm39) G488S probably damaging Het
Usp34 A C 11: 23,399,268 (GRCm39) K2419T Het
Vps13d T C 4: 144,801,622 (GRCm39) Q3532R Het
Vps4a A T 8: 107,767,529 (GRCm39) I163L probably damaging Het
Wrn T C 8: 33,814,454 (GRCm39) H330R probably benign Het
Xpr1 T C 1: 155,188,618 (GRCm39) I341V probably benign Het
Zfyve9 T C 4: 108,548,973 (GRCm39) E105G probably benign Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62,357,126 (GRCm39) missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61,787,649 (GRCm39) nonsense probably null
IGL01012:Ccser1 APN 6 61,615,474 (GRCm39) missense probably benign 0.01
IGL01391:Ccser1 APN 6 61,615,505 (GRCm39) splice site probably benign
IGL01643:Ccser1 APN 6 61,288,839 (GRCm39) missense probably benign 0.01
IGL01767:Ccser1 APN 6 61,695,136 (GRCm39) missense probably benign 0.03
IGL02081:Ccser1 APN 6 61,288,152 (GRCm39) nonsense probably null
IGL02152:Ccser1 APN 6 61,288,692 (GRCm39) missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61,288,276 (GRCm39) missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62,356,815 (GRCm39) missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61,289,144 (GRCm39) missense probably benign 0.02
R0020:Ccser1 UTSW 6 61,290,788 (GRCm39) missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61,400,045 (GRCm39) missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62,357,090 (GRCm39) missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62,357,016 (GRCm39) missense probably benign 0.00
R1650:Ccser1 UTSW 6 61,615,474 (GRCm39) missense probably benign 0.01
R1653:Ccser1 UTSW 6 61,288,449 (GRCm39) missense probably benign 0.00
R1913:Ccser1 UTSW 6 62,356,878 (GRCm39) missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61,290,630 (GRCm39) splice site probably benign
R2030:Ccser1 UTSW 6 61,288,547 (GRCm39) missense probably benign
R2056:Ccser1 UTSW 6 61,399,936 (GRCm39) splice site probably null
R2268:Ccser1 UTSW 6 61,547,827 (GRCm39) missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61,547,799 (GRCm39) missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61,547,799 (GRCm39) missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61,399,944 (GRCm39) missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61,288,568 (GRCm39) missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61,288,910 (GRCm39) missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61,288,485 (GRCm39) missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61,695,175 (GRCm39) missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61,288,350 (GRCm39) missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61,289,144 (GRCm39) missense probably benign 0.02
R5221:Ccser1 UTSW 6 61,289,075 (GRCm39) missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61,288,650 (GRCm39) missense probably benign 0.00
R5604:Ccser1 UTSW 6 61,290,788 (GRCm39) missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61,288,260 (GRCm39) missense probably benign 0.00
R5970:Ccser1 UTSW 6 61,288,226 (GRCm39) missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 62,356,769 (GRCm39) missense probably benign
R6257:Ccser1 UTSW 6 61,350,946 (GRCm39) missense probably damaging 0.96
R6375:Ccser1 UTSW 6 61,288,152 (GRCm39) nonsense probably null
R6703:Ccser1 UTSW 6 61,615,495 (GRCm39) nonsense probably null
R6930:Ccser1 UTSW 6 62,357,009 (GRCm39) missense probably benign 0.03
R7256:Ccser1 UTSW 6 61,288,851 (GRCm39) missense probably benign 0.38
R7362:Ccser1 UTSW 6 61,787,864 (GRCm39) missense unknown
R7508:Ccser1 UTSW 6 61,547,707 (GRCm39) missense probably benign 0.05
R7532:Ccser1 UTSW 6 62,356,915 (GRCm39) nonsense probably null
R7533:Ccser1 UTSW 6 61,615,474 (GRCm39) missense probably benign 0.25
R7875:Ccser1 UTSW 6 61,288,932 (GRCm39) missense probably benign 0.06
R8055:Ccser1 UTSW 6 61,290,757 (GRCm39) missense possibly damaging 0.47
R8396:Ccser1 UTSW 6 61,289,088 (GRCm39) missense probably benign 0.09
R8724:Ccser1 UTSW 6 61,288,199 (GRCm39) missense probably damaging 0.99
R8849:Ccser1 UTSW 6 61,288,537 (GRCm39) missense probably benign 0.00
R8906:Ccser1 UTSW 6 61,787,842 (GRCm39) missense probably benign 0.00
R9058:Ccser1 UTSW 6 61,350,976 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTCCTAAAAGTGGAAGCAC -3'
(R):5'- AAAGCGTTCAGCCAATGCC -3'

Sequencing Primer
(F):5'- CGGCATCACACTGTGACAATTTTG -3'
(R):5'- AGCCAATGCCTTGTGCTG -3'
Posted On 2019-11-12