Incidental Mutation 'R0242:Arhgef25'
ID 59571
Institutional Source Beutler Lab
Gene Symbol Arhgef25
Ensembl Gene ENSMUSG00000019467
Gene Name Rho guanine nucleotide exchange factor 25
Synonyms GEFT, D10Ertd610e, 2410008H17Rik
MMRRC Submission 038480-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.203) question?
Stock # R0242 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 127018394-127025952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 127019933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 435 (G435E)
Ref Sequence ENSEMBL: ENSMUSP00000152503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019611] [ENSMUST00000095270] [ENSMUST00000167353] [ENSMUST00000218587] [ENSMUST00000218654] [ENSMUST00000219245] [ENSMUST00000222006] [ENSMUST00000222911]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000019611
AA Change: G435E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467
AA Change: G435E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095270
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167353
AA Change: G426E

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467
AA Change: G426E

DomainStartEndE-ValueType
low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218478
Predicted Effect probably benign
Transcript: ENSMUST00000218587
Predicted Effect probably benign
Transcript: ENSMUST00000218654
AA Change: G396E

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000218864
Predicted Effect probably benign
Transcript: ENSMUST00000219245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219428
Predicted Effect probably damaging
Transcript: ENSMUST00000222006
AA Change: G435E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221174
Predicted Effect probably benign
Transcript: ENSMUST00000222911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220295
Meta Mutation Damage Score 0.1171 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases alternate between an inactive GDP-bound state and an active GTP-bound state, and GEFs facilitate GDP/GTP exchange. This gene encodes a guanine nucleotide exchange factor (GEF) which interacts with Rho GTPases involved in contraction of vascular smooth muscles, regulation of responses to angiotensin II and lens cell differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in the second heart field exhibit normal cardiac development and prenatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,601,676 (GRCm39) D230G probably benign Het
Abhd13 A G 8: 10,037,561 (GRCm39) I53V probably benign Het
Adgrl2 A C 3: 148,544,821 (GRCm39) probably null Het
Aldh16a1 G A 7: 44,794,088 (GRCm39) A596V probably damaging Het
Aldh3b2 T A 19: 4,029,414 (GRCm39) Y262* probably null Het
Ambn A G 5: 88,615,831 (GRCm39) Q420R possibly damaging Het
Ankib1 A C 5: 3,750,344 (GRCm39) probably benign Het
Arhgap9 C A 10: 127,165,407 (GRCm39) H430Q probably benign Het
Armc12 A T 17: 28,751,366 (GRCm39) D120V possibly damaging Het
Asxl3 G A 18: 22,649,738 (GRCm39) E576K possibly damaging Het
Bcdin3d T C 15: 99,368,776 (GRCm39) E141G probably benign Het
Bmpr1b G A 3: 141,546,437 (GRCm39) T483M probably damaging Het
Caprin2 C T 6: 148,744,452 (GRCm39) S991N probably damaging Het
Cd96 T C 16: 45,892,129 (GRCm39) I286M possibly damaging Het
Cdcp1 G T 9: 123,009,237 (GRCm39) F480L probably benign Het
Celf5 T C 10: 81,300,243 (GRCm39) T258A probably benign Het
Cgnl1 A G 9: 71,628,939 (GRCm39) V577A probably damaging Het
Clca3b A G 3: 144,547,226 (GRCm39) S304P probably benign Het
Cmya5 A T 13: 93,232,108 (GRCm39) H993Q probably benign Het
Cnbp A T 6: 87,822,746 (GRCm39) C6S probably damaging Het
Col14a1 C T 15: 55,360,907 (GRCm39) R1605W probably damaging Het
Cops7a T C 6: 124,941,817 (GRCm39) N11S probably benign Het
Coro7 T C 16: 4,448,042 (GRCm39) probably benign Het
Cpvl T C 6: 53,909,485 (GRCm39) H217R possibly damaging Het
Cuedc1 T C 11: 88,075,447 (GRCm39) probably benign Het
Cyp2c66 A G 19: 39,130,369 (GRCm39) Y68C probably damaging Het
Dicer1 G A 12: 104,668,710 (GRCm39) T1324M probably benign Het
Dlgap2 A G 8: 14,777,562 (GRCm39) D268G probably benign Het
Dnm1 T A 2: 32,207,001 (GRCm39) M535L possibly damaging Het
Dock7 A T 4: 98,850,517 (GRCm39) F1575Y probably benign Het
Dpp10 T A 1: 123,326,275 (GRCm39) H403L possibly damaging Het
Dync1h1 A G 12: 110,616,285 (GRCm39) D3112G possibly damaging Het
Eno3 A G 11: 70,548,761 (GRCm39) E21G probably null Het
Fam120b T A 17: 15,643,186 (GRCm39) V655D probably damaging Het
Fkbp5 A T 17: 28,647,426 (GRCm39) D136E probably benign Het
Gdap1l1 T A 2: 163,289,573 (GRCm39) Y179* probably null Het
Gfer A G 17: 24,913,277 (GRCm39) W192R probably damaging Het
Gm4782 A G 6: 50,586,838 (GRCm39) T408A probably benign Het
Golgb1 C T 16: 36,695,992 (GRCm39) Q164* probably null Het
Gpnmb A G 6: 49,024,276 (GRCm39) N197S probably damaging Het
Gtf2f1 G A 17: 57,310,802 (GRCm39) T414M probably benign Het
Hc A G 2: 34,926,166 (GRCm39) probably benign Het
Hcfc1 A T X: 72,992,035 (GRCm39) probably benign Het
Helz2 C T 2: 180,872,223 (GRCm39) R2539Q probably damaging Het
Hsd17b12 T A 2: 93,988,160 (GRCm39) I19F probably benign Het
Incenp T C 19: 9,871,114 (GRCm39) T172A unknown Het
Jmy A G 13: 93,578,126 (GRCm39) Y681H probably benign Het
Kbtbd11 A G 8: 15,077,508 (GRCm39) T36A probably benign Het
Kcnh4 T C 11: 100,646,525 (GRCm39) D267G probably damaging Het
Krt34 C T 11: 99,932,157 (GRCm39) E56K probably damaging Het
Krt40 T A 11: 99,429,568 (GRCm39) E335D probably damaging Het
Krt86 T A 15: 101,374,454 (GRCm39) Y282* probably null Het
Lgi3 C T 14: 70,772,255 (GRCm39) R267* probably null Het
Lnpk A G 2: 74,367,633 (GRCm39) probably benign Het
Lrp1b T A 2: 40,888,195 (GRCm39) H2355L probably benign Het
Lrrc8e G A 8: 4,285,401 (GRCm39) R542H probably benign Het
Mia2 T C 12: 59,155,642 (GRCm39) Y452H probably damaging Het
Mmachc C T 4: 116,561,738 (GRCm39) R132Q probably damaging Het
Mtbp T A 15: 55,440,882 (GRCm39) N356K possibly damaging Het
Myo5b A G 18: 74,794,787 (GRCm39) H552R possibly damaging Het
Niban1 A G 1: 151,593,967 (GRCm39) D884G probably benign Het
Noxred1 A G 12: 87,273,753 (GRCm39) V96A probably benign Het
Nr1d2 T A 14: 18,211,933 (GRCm38) D390V possibly damaging Het
Oas1e A T 5: 120,929,839 (GRCm39) probably benign Het
Odad2 A T 18: 7,211,516 (GRCm39) V786D probably damaging Het
Or1r1 T C 11: 73,874,538 (GRCm39) S299G probably benign Het
Or6c1b T A 10: 129,273,217 (GRCm39) Y179N probably damaging Het
Otog G T 7: 45,916,805 (GRCm39) C914F probably damaging Het
Pank2 G T 2: 131,122,117 (GRCm39) C214F probably damaging Het
Pcdhb1 T A 18: 37,399,788 (GRCm39) S580T probably benign Het
Pdia3 T C 2: 121,244,592 (GRCm39) S2P probably damaging Het
Peli1 G T 11: 21,092,602 (GRCm39) R83L probably damaging Het
Pla2g3 T A 11: 3,441,935 (GRCm39) C366* probably null Het
Pon3 T A 6: 5,240,860 (GRCm39) D107V probably benign Het
Ppip5k2 A G 1: 97,668,816 (GRCm39) C532R probably damaging Het
Prph A T 15: 98,953,608 (GRCm39) D174V probably damaging Het
Psd3 A G 8: 68,210,738 (GRCm39) M270T probably damaging Het
Pum3 A G 19: 27,400,155 (GRCm39) probably benign Het
Pus1 A T 5: 110,927,664 (GRCm39) H30Q probably benign Het
Pwwp3a T C 10: 80,070,092 (GRCm39) S354P probably benign Het
Rab7 A T 6: 87,982,114 (GRCm39) V87E probably damaging Het
Rbm5 A T 9: 107,628,907 (GRCm39) probably benign Het
Reln A G 5: 22,147,595 (GRCm39) probably null Het
S1pr3 A G 13: 51,572,938 (GRCm39) T40A probably benign Het
Sdk1 T A 5: 142,129,677 (GRCm39) probably benign Het
Senp7 T A 16: 55,999,884 (GRCm39) I853N probably damaging Het
Serpinb6c T A 13: 34,083,230 (GRCm39) probably benign Het
Shroom1 T G 11: 53,356,312 (GRCm39) probably null Het
Slc24a3 T C 2: 145,448,584 (GRCm39) I376T probably benign Het
Slc46a1 T C 11: 78,359,493 (GRCm39) I375T possibly damaging Het
Slc4a9 T C 18: 36,666,733 (GRCm39) F527S probably damaging Het
Slc4a9 T A 18: 36,674,286 (GRCm39) I924N probably damaging Het
Slx4 T A 16: 3,804,816 (GRCm39) E666V probably damaging Het
Snrnp27 G A 6: 86,652,575 (GRCm39) probably benign Het
Sorcs1 C T 19: 50,216,659 (GRCm39) G640E probably damaging Het
Spmap2l G T 5: 77,164,152 (GRCm39) E52* probably null Het
Sptan1 A T 2: 29,908,413 (GRCm39) M1725L probably benign Het
Sync G A 4: 129,187,514 (GRCm39) R182K probably damaging Het
Syne2 G A 12: 76,144,808 (GRCm39) G1586S probably damaging Het
Sytl1 G T 4: 132,980,768 (GRCm39) T522K probably damaging Het
Tex2 T A 11: 106,410,781 (GRCm39) K414* probably null Het
Tex55 C T 16: 38,644,929 (GRCm39) probably benign Het
Thsd7a G A 6: 12,503,915 (GRCm39) T413I probably benign Het
Tm9sf1 C T 14: 55,875,392 (GRCm39) A451T possibly damaging Het
Ttn A T 2: 76,656,496 (GRCm39) probably benign Het
Uba2 T C 7: 33,854,054 (GRCm39) I140V possibly damaging Het
Ushbp1 C A 8: 71,842,762 (GRCm39) G361* probably null Het
Wbp2nl C T 15: 82,197,988 (GRCm39) A175V probably benign Het
Zc3h12d A G 10: 7,738,330 (GRCm39) E212G probably damaging Het
Zc3h7b T C 15: 81,653,031 (GRCm39) probably benign Het
Other mutations in Arhgef25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Arhgef25 APN 10 127,020,039 (GRCm39) missense probably damaging 1.00
IGL02499:Arhgef25 APN 10 127,021,460 (GRCm39) missense probably damaging 1.00
IGL03276:Arhgef25 APN 10 127,021,794 (GRCm39) missense possibly damaging 0.78
R0021:Arhgef25 UTSW 10 127,025,423 (GRCm39) missense probably benign 0.00
R0038:Arhgef25 UTSW 10 127,022,734 (GRCm39) splice site probably benign
R0038:Arhgef25 UTSW 10 127,022,734 (GRCm39) splice site probably benign
R0106:Arhgef25 UTSW 10 127,019,879 (GRCm39) critical splice donor site probably null
R0242:Arhgef25 UTSW 10 127,019,933 (GRCm39) missense probably damaging 1.00
R0358:Arhgef25 UTSW 10 127,020,322 (GRCm39) missense probably damaging 1.00
R0505:Arhgef25 UTSW 10 127,019,566 (GRCm39) missense probably null 0.03
R0676:Arhgef25 UTSW 10 127,019,879 (GRCm39) critical splice donor site probably null
R1185:Arhgef25 UTSW 10 127,019,650 (GRCm39) missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127,019,650 (GRCm39) missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127,019,650 (GRCm39) missense possibly damaging 0.85
R1600:Arhgef25 UTSW 10 127,021,158 (GRCm39) missense probably damaging 0.99
R1846:Arhgef25 UTSW 10 127,021,733 (GRCm39) missense probably damaging 1.00
R2055:Arhgef25 UTSW 10 127,021,004 (GRCm39) missense probably damaging 1.00
R2254:Arhgef25 UTSW 10 127,025,390 (GRCm39) missense probably benign 0.01
R2496:Arhgef25 UTSW 10 127,023,063 (GRCm39) missense probably benign 0.08
R3836:Arhgef25 UTSW 10 127,025,605 (GRCm39) missense probably benign
R3837:Arhgef25 UTSW 10 127,025,605 (GRCm39) missense probably benign
R3838:Arhgef25 UTSW 10 127,025,605 (GRCm39) missense probably benign
R3839:Arhgef25 UTSW 10 127,025,605 (GRCm39) missense probably benign
R3950:Arhgef25 UTSW 10 127,021,013 (GRCm39) missense probably damaging 1.00
R3980:Arhgef25 UTSW 10 127,023,089 (GRCm39) missense probably damaging 1.00
R4883:Arhgef25 UTSW 10 127,018,802 (GRCm39) missense probably benign 0.43
R4964:Arhgef25 UTSW 10 127,021,472 (GRCm39) missense probably damaging 1.00
R5192:Arhgef25 UTSW 10 127,020,978 (GRCm39) missense probably damaging 1.00
R5196:Arhgef25 UTSW 10 127,020,978 (GRCm39) missense probably damaging 1.00
R5420:Arhgef25 UTSW 10 127,023,143 (GRCm39) missense probably benign 0.37
R6301:Arhgef25 UTSW 10 127,021,751 (GRCm39) missense possibly damaging 0.88
R6764:Arhgef25 UTSW 10 127,019,970 (GRCm39) missense probably damaging 1.00
R7096:Arhgef25 UTSW 10 127,019,897 (GRCm39) missense probably damaging 1.00
R7289:Arhgef25 UTSW 10 127,019,641 (GRCm39) missense possibly damaging 0.92
R7482:Arhgef25 UTSW 10 127,021,540 (GRCm39) missense probably damaging 1.00
R8170:Arhgef25 UTSW 10 127,023,048 (GRCm39) missense probably damaging 1.00
R8364:Arhgef25 UTSW 10 127,025,632 (GRCm39) missense unknown
R8477:Arhgef25 UTSW 10 127,020,266 (GRCm39) missense probably damaging 1.00
R8987:Arhgef25 UTSW 10 127,018,735 (GRCm39) missense probably damaging 1.00
R9014:Arhgef25 UTSW 10 127,019,607 (GRCm39) missense probably damaging 1.00
R9036:Arhgef25 UTSW 10 127,019,089 (GRCm39) missense probably benign
R9654:Arhgef25 UTSW 10 127,021,955 (GRCm39) missense probably damaging 1.00
X0018:Arhgef25 UTSW 10 127,019,568 (GRCm39) missense probably damaging 1.00
X0024:Arhgef25 UTSW 10 127,019,126 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACCTGGATTGGCAATCAGAGAC -3'
(R):5'- TGAGGAATTACCTCCTTGGGCGTG -3'

Sequencing Primer
(F):5'- GAGACAGCTCTCAGATTCTGC -3'
(R):5'- TGTTGCGCCTTCTCAGAG -3'
Posted On 2013-07-11