Incidental Mutation 'R7729:Wrn'
ID 595712
Institutional Source Beutler Lab
Gene Symbol Wrn
Ensembl Gene ENSMUSG00000031583
Gene Name Werner syndrome RecQ like helicase
Synonyms
MMRRC Submission 045785-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.301) question?
Stock # R7729 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 33724412-33875555 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33814454 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 330 (H330R)
Ref Sequence ENSEMBL: ENSMUSP00000033990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991] [ENSMUST00000211498]
AlphaFold O09053
PDB Structure structure of mouse WRN exonuclease domain [X-RAY DIFFRACTION]
structure of mouse werner exonuclease domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033990
AA Change: H330R

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583
AA Change: H330R

DomainStartEndE-ValueType
35EXOc 47 226 1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.3e-28 SMART
HELICc 743 824 3.7e-27 SMART
RQC 923 1028 3.1e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1222 1318 2.7e-9 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033991
AA Change: H330R

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583
AA Change: H330R

DomainStartEndE-ValueType
35EXOc 47 226 1.1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.4e-28 SMART
HELICc 743 824 3.7e-27 SMART
Pfam:RecQ_Zn_bind 835 905 2.2e-8 PFAM
RQC 923 1028 3.2e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1223 1317 4.3e-10 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211498
AA Change: H87R

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RecQ subfamily and the DEAH (Asp-Glu-Ala-His) subfamily of DNA and RNA helicases. DNA helicases are involved in many aspects of DNA metabolism, including transcription, replication, recombination, and repair. This protein contains a nuclear localization signal in the C-terminus and shows a predominant nucleolar localization. It possesses an intrinsic 3' to 5' DNA helicase activity, and is also a 3' to 5' exonuclease. Based on interactions between this protein and Ku70/80 heterodimer in DNA end processing, this protein may be involved in the repair of double strand DNA breaks. Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show enhanced frequency and variety of tumors in conjunction with Trp53 knockout alleles. Homozygotes also have an elevated frequency of somatic reversion of the pink-eyed dilution unstable mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T G 2: 127,028,710 (GRCm39) D163A possibly damaging Het
Abce1 A T 8: 80,414,537 (GRCm39) I454N probably damaging Het
Acaca A G 11: 84,262,339 (GRCm39) I1980M probably damaging Het
Adgrb2 C T 4: 129,885,917 (GRCm39) T19M probably benign Het
Agmo T A 12: 37,464,974 (GRCm39) S417T probably benign Het
Akap8l T C 17: 32,552,068 (GRCm39) E403G probably damaging Het
Art5 C T 7: 101,747,711 (GRCm39) A23T possibly damaging Het
Atg9a T C 1: 75,161,204 (GRCm39) T681A probably benign Het
Atp11b A G 3: 35,832,256 (GRCm39) Q37R probably damaging Het
Atp2a2 T C 5: 122,629,829 (GRCm39) E80G probably benign Het
AW551984 G A 9: 39,511,071 (GRCm39) P172L possibly damaging Het
Bace1 C T 9: 45,769,743 (GRCm39) R296C probably damaging Het
Ccser1 T A 6: 61,288,840 (GRCm39) H334Q probably benign Het
Chtf18 C T 17: 25,942,491 (GRCm39) R449H probably damaging Het
Cit A G 5: 116,122,881 (GRCm39) H1384R possibly damaging Het
Cltc A G 11: 86,612,474 (GRCm39) I524T probably benign Het
Dctn1 T A 6: 83,160,042 (GRCm39) I94N probably damaging Het
Dnhd1 A T 7: 105,354,472 (GRCm39) D3078V probably damaging Het
Dock7 G A 4: 98,943,683 (GRCm39) P520S Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Eprs1 T A 1: 185,145,366 (GRCm39) Y1130N probably damaging Het
Fcgrt T C 7: 44,744,797 (GRCm39) T224A probably damaging Het
Flt1 T A 5: 147,637,177 (GRCm39) T39S probably benign Het
Fxyd1 T C 7: 30,752,896 (GRCm39) Y33C probably damaging Het
Gab2 T A 7: 96,950,633 (GRCm39) V442E probably damaging Het
Ganab A G 19: 8,892,076 (GRCm39) D800G probably benign Het
Gata4 C A 14: 63,478,186 (GRCm39) A138S probably benign Het
Golga4 A G 9: 118,385,131 (GRCm39) H751R possibly damaging Het
H1f6 A G 13: 23,880,455 (GRCm39) R203G possibly damaging Het
Htra4 A G 8: 25,527,093 (GRCm39) V234A possibly damaging Het
Igkv4-74 A T 6: 69,161,954 (GRCm39) Y72N probably damaging Het
Iqsec3 T C 6: 121,360,940 (GRCm39) K973E probably damaging Het
Khdc1b C A 1: 21,455,065 (GRCm39) T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 141,850,333 (GRCm39) probably benign Het
Kyat3 A G 3: 142,432,066 (GRCm39) probably null Het
Lrba T A 3: 86,225,474 (GRCm39) V666E probably damaging Het
Mettl25 T A 10: 105,601,871 (GRCm39) Y528F probably benign Het
Mms19 A T 19: 41,940,904 (GRCm39) Y619* probably null Het
Nlrp12 A C 7: 3,277,020 (GRCm39) probably null Het
Nol10 C T 12: 17,474,676 (GRCm39) L623F possibly damaging Het
Oas1g A G 5: 121,024,063 (GRCm39) F82S probably damaging Het
Or1j8 T G 2: 36,191,772 (GRCm39) S74A probably benign Het
Or5k3 C T 16: 58,969,570 (GRCm39) A119V probably damaging Het
Or8g18 G A 9: 39,149,546 (GRCm39) P58L probably benign Het
Oxr1 G A 15: 41,686,863 (GRCm39) E582K probably damaging Het
Pdia3 A G 2: 121,262,838 (GRCm39) D268G possibly damaging Het
Pramel13 T C 4: 144,119,434 (GRCm39) S378G probably damaging Het
Rcor3 A G 1: 191,786,078 (GRCm39) Y387H probably damaging Het
Rigi T A 4: 40,206,034 (GRCm39) I853F possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,118 (GRCm39) probably benign Het
Rsl1 T C 13: 67,330,284 (GRCm39) L244P possibly damaging Het
Scn5a G T 9: 119,324,606 (GRCm39) N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 (GRCm39) A24V probably benign Het
Slc22a8 A G 19: 8,571,323 (GRCm39) Y18C possibly damaging Het
Slc35d1 C T 4: 103,072,044 (GRCm39) R7H probably damaging Het
Slco6d1 A T 1: 98,425,248 (GRCm39) T599S probably damaging Het
Spata31d1e C T 13: 59,889,437 (GRCm39) M794I not run Het
St18 T A 1: 6,872,761 (GRCm39) H165Q probably benign Het
Sub1 C T 15: 11,986,589 (GRCm39) R86K probably damaging Het
Tectb G A 19: 55,181,104 (GRCm39) V148M Het
Tgfb2 C A 1: 186,362,954 (GRCm39) G290V possibly damaging Het
Tgm7 T C 2: 120,924,191 (GRCm39) H577R probably benign Het
Tle2 T C 10: 81,422,981 (GRCm39) S460P probably damaging Het
Tmem221 C A 8: 72,011,446 (GRCm39) R3L possibly damaging Het
Tnfrsf19 C A 14: 61,212,183 (GRCm39) V156L possibly damaging Het
Trav6-5 A G 14: 53,728,964 (GRCm39) K75E probably benign Het
Trip10 G A 17: 57,569,442 (GRCm39) G488S probably damaging Het
Usp34 A C 11: 23,399,268 (GRCm39) K2419T Het
Vps13d T C 4: 144,801,622 (GRCm39) Q3532R Het
Vps4a A T 8: 107,767,529 (GRCm39) I163L probably damaging Het
Xpr1 T C 1: 155,188,618 (GRCm39) I341V probably benign Het
Zfyve9 T C 4: 108,548,973 (GRCm39) E105G probably benign Het
Other mutations in Wrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Wrn APN 8 33,812,405 (GRCm39) splice site probably benign
IGL00661:Wrn APN 8 33,809,173 (GRCm39) splice site probably benign
IGL01472:Wrn APN 8 33,819,200 (GRCm39) missense possibly damaging 0.93
IGL01544:Wrn APN 8 33,814,554 (GRCm39) missense probably benign 0.00
IGL01599:Wrn APN 8 33,731,039 (GRCm39) missense possibly damaging 0.69
IGL01688:Wrn APN 8 33,800,730 (GRCm39) splice site probably benign
IGL01916:Wrn APN 8 33,747,252 (GRCm39) missense possibly damaging 0.78
IGL01925:Wrn APN 8 33,809,208 (GRCm39) missense probably benign 0.42
IGL02068:Wrn APN 8 33,800,777 (GRCm39) missense probably benign 0.38
IGL02084:Wrn APN 8 33,775,207 (GRCm39) missense probably benign
IGL02167:Wrn APN 8 33,807,583 (GRCm39) missense probably damaging 1.00
IGL02230:Wrn APN 8 33,807,591 (GRCm39) missense probably damaging 1.00
IGL02717:Wrn APN 8 33,833,601 (GRCm39) missense probably damaging 1.00
IGL02982:Wrn APN 8 33,833,094 (GRCm39) missense probably damaging 1.00
IGL03030:Wrn APN 8 33,738,989 (GRCm39) missense possibly damaging 0.94
IGL03088:Wrn APN 8 33,758,851 (GRCm39) splice site probably benign
IGL03179:Wrn APN 8 33,800,734 (GRCm39) splice site probably null
IGL03306:Wrn APN 8 33,826,149 (GRCm39) missense probably damaging 1.00
R0004:Wrn UTSW 8 33,807,588 (GRCm39) missense probably damaging 1.00
R0190:Wrn UTSW 8 33,731,011 (GRCm39) missense probably benign 0.02
R0441:Wrn UTSW 8 33,758,778 (GRCm39) missense probably benign 0.24
R0463:Wrn UTSW 8 33,770,843 (GRCm39) missense possibly damaging 0.84
R0538:Wrn UTSW 8 33,826,119 (GRCm39) missense probably damaging 0.99
R0682:Wrn UTSW 8 33,757,848 (GRCm39) missense probably benign 0.00
R0729:Wrn UTSW 8 33,738,946 (GRCm39) splice site probably null
R0744:Wrn UTSW 8 33,785,034 (GRCm39) missense possibly damaging 0.91
R0836:Wrn UTSW 8 33,785,034 (GRCm39) missense possibly damaging 0.91
R1168:Wrn UTSW 8 33,806,436 (GRCm39) missense probably damaging 1.00
R1301:Wrn UTSW 8 33,782,714 (GRCm39) missense probably damaging 1.00
R1352:Wrn UTSW 8 33,784,944 (GRCm39) missense probably benign 0.25
R1396:Wrn UTSW 8 33,758,847 (GRCm39) missense probably damaging 1.00
R1432:Wrn UTSW 8 33,809,169 (GRCm39) splice site probably benign
R1523:Wrn UTSW 8 33,782,744 (GRCm39) missense probably benign 0.23
R1625:Wrn UTSW 8 33,819,158 (GRCm39) missense probably benign 0.01
R1664:Wrn UTSW 8 33,770,794 (GRCm39) splice site probably null
R1773:Wrn UTSW 8 33,833,589 (GRCm39) missense probably damaging 1.00
R1864:Wrn UTSW 8 33,778,892 (GRCm39) missense probably damaging 0.99
R1868:Wrn UTSW 8 33,747,249 (GRCm39) missense probably benign 0.03
R2011:Wrn UTSW 8 33,726,432 (GRCm39) missense probably benign 0.02
R2075:Wrn UTSW 8 33,812,357 (GRCm39) missense probably benign 0.00
R2091:Wrn UTSW 8 33,757,853 (GRCm39) missense probably benign
R2213:Wrn UTSW 8 33,747,043 (GRCm39) missense probably benign 0.05
R2255:Wrn UTSW 8 33,819,230 (GRCm39) missense probably benign 0.13
R2276:Wrn UTSW 8 33,814,584 (GRCm39) missense probably benign 0.02
R3177:Wrn UTSW 8 33,807,582 (GRCm39) missense probably damaging 1.00
R3277:Wrn UTSW 8 33,807,582 (GRCm39) missense probably damaging 1.00
R3779:Wrn UTSW 8 33,731,048 (GRCm39) missense probably damaging 1.00
R3827:Wrn UTSW 8 33,814,548 (GRCm39) missense probably benign 0.00
R4111:Wrn UTSW 8 33,842,183 (GRCm39) missense probably benign 0.02
R4392:Wrn UTSW 8 33,741,860 (GRCm39) missense probably damaging 0.99
R4458:Wrn UTSW 8 33,785,026 (GRCm39) missense probably damaging 0.99
R4650:Wrn UTSW 8 33,745,537 (GRCm39) missense probably benign 0.05
R4656:Wrn UTSW 8 33,826,019 (GRCm39) splice site probably null
R4657:Wrn UTSW 8 33,826,019 (GRCm39) splice site probably null
R4667:Wrn UTSW 8 33,814,366 (GRCm39) missense probably benign 0.00
R4735:Wrn UTSW 8 33,775,250 (GRCm39) missense probably damaging 1.00
R4933:Wrn UTSW 8 33,812,371 (GRCm39) missense probably benign 0.01
R5104:Wrn UTSW 8 33,757,895 (GRCm39) splice site probably null
R5166:Wrn UTSW 8 33,842,100 (GRCm39) critical splice donor site probably null
R5279:Wrn UTSW 8 33,731,129 (GRCm39) missense probably damaging 1.00
R5400:Wrn UTSW 8 33,784,945 (GRCm39) missense probably benign 0.02
R5575:Wrn UTSW 8 33,826,158 (GRCm39) missense probably benign 0.02
R5695:Wrn UTSW 8 33,814,346 (GRCm39) missense probably benign 0.26
R5729:Wrn UTSW 8 33,758,806 (GRCm39) missense probably benign 0.02
R6044:Wrn UTSW 8 33,726,457 (GRCm39) missense probably damaging 1.00
R6139:Wrn UTSW 8 33,843,360 (GRCm39) missense probably damaging 1.00
R6158:Wrn UTSW 8 33,809,200 (GRCm39) missense probably damaging 1.00
R6192:Wrn UTSW 8 33,774,682 (GRCm39) missense probably benign 0.12
R6243:Wrn UTSW 8 33,774,682 (GRCm39) missense possibly damaging 0.94
R6354:Wrn UTSW 8 33,833,666 (GRCm39) missense possibly damaging 0.93
R6429:Wrn UTSW 8 33,833,024 (GRCm39) missense probably damaging 1.00
R6490:Wrn UTSW 8 33,809,248 (GRCm39) missense probably benign 0.01
R6529:Wrn UTSW 8 33,826,004 (GRCm39) splice site probably null
R6535:Wrn UTSW 8 33,826,131 (GRCm39) missense probably damaging 0.99
R7001:Wrn UTSW 8 33,842,157 (GRCm39) missense probably benign 0.04
R7114:Wrn UTSW 8 33,775,149 (GRCm39) frame shift probably null
R7198:Wrn UTSW 8 33,814,346 (GRCm39) missense probably benign 0.00
R7200:Wrn UTSW 8 33,812,376 (GRCm39) missense probably benign 0.00
R7227:Wrn UTSW 8 33,738,974 (GRCm39) missense probably damaging 1.00
R7299:Wrn UTSW 8 33,782,746 (GRCm39) missense probably damaging 1.00
R7374:Wrn UTSW 8 33,758,939 (GRCm39) missense probably damaging 1.00
R7402:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7404:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7405:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7464:Wrn UTSW 8 33,826,024 (GRCm39) critical splice donor site probably null
R7474:Wrn UTSW 8 33,819,209 (GRCm39) missense probably damaging 0.96
R7609:Wrn UTSW 8 33,800,741 (GRCm39) missense possibly damaging 0.50
R7830:Wrn UTSW 8 33,759,082 (GRCm39) missense probably damaging 0.97
R7998:Wrn UTSW 8 33,782,671 (GRCm39) missense probably benign 0.10
R8239:Wrn UTSW 8 33,819,213 (GRCm39) missense probably damaging 1.00
R8262:Wrn UTSW 8 33,814,274 (GRCm39) missense probably benign 0.07
R8410:Wrn UTSW 8 33,759,048 (GRCm39) missense probably damaging 1.00
R8480:Wrn UTSW 8 33,778,796 (GRCm39) missense probably benign 0.10
R8530:Wrn UTSW 8 33,770,852 (GRCm39) missense possibly damaging 0.83
R8540:Wrn UTSW 8 33,842,154 (GRCm39) missense probably damaging 0.96
R8708:Wrn UTSW 8 33,782,671 (GRCm39) missense probably damaging 0.96
R8783:Wrn UTSW 8 33,826,041 (GRCm39) missense probably null 1.00
R8870:Wrn UTSW 8 33,819,220 (GRCm39) missense probably benign 0.01
R8876:Wrn UTSW 8 33,814,422 (GRCm39) missense probably benign 0.00
R9050:Wrn UTSW 8 33,833,021 (GRCm39) missense probably damaging 1.00
R9329:Wrn UTSW 8 33,731,006 (GRCm39) missense probably benign
R9595:Wrn UTSW 8 33,758,961 (GRCm39) missense probably benign
R9621:Wrn UTSW 8 33,814,301 (GRCm39) missense probably benign 0.01
R9623:Wrn UTSW 8 33,774,644 (GRCm39) critical splice donor site probably null
R9797:Wrn UTSW 8 33,758,950 (GRCm39) missense probably benign 0.02
RF010:Wrn UTSW 8 33,778,793 (GRCm39) missense probably benign 0.13
X0017:Wrn UTSW 8 33,770,810 (GRCm39) missense probably damaging 1.00
Z1176:Wrn UTSW 8 33,824,237 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTAGGAATCACACAAGTTCTTTCC -3'
(R):5'- CTCAGTAAGCCTTCGTTCAGTAAG -3'

Sequencing Primer
(F):5'- GGAATCACACAAGTTCTTTCCATATC -3'
(R):5'- GGTCCTACAAACACTGAGAC -3'
Posted On 2019-11-12