Incidental Mutation 'R7729:Golga4'
ID595719
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Namegolgi autoantigen, golgin subfamily a, 4
Synonymsgolgin-245, Olp-1
Accession Numbers

Genbank: NM_018748; MGI: 1859646  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7729 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location118506267-118582519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118556063 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 751 (H751R)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084820
AA Change: H751R

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: H751R

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211840
Predicted Effect probably benign
Transcript: ENSMUST00000212097
AA Change: H723R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,623 M794I not run Het
1810024B03Rik T G 2: 127,186,790 D163A possibly damaging Het
Abce1 A T 8: 79,687,908 I454N probably damaging Het
Acaca A G 11: 84,371,513 I1980M probably damaging Het
Adgrb2 C T 4: 129,992,124 T19M probably benign Het
Agmo T A 12: 37,414,975 S417T probably benign Het
Akap8l T C 17: 32,333,094 E403G probably damaging Het
Art5 C T 7: 102,098,504 A23T possibly damaging Het
Atg9a T C 1: 75,184,560 T681A probably benign Het
Atp11b A G 3: 35,778,107 Q37R probably damaging Het
Atp2a2 T C 5: 122,491,766 E80G probably benign Het
AW551984 G A 9: 39,599,775 P172L possibly damaging Het
Bace1 C T 9: 45,858,445 R296C probably damaging Het
Ccser1 T A 6: 61,311,856 H334Q probably benign Het
Chtf18 C T 17: 25,723,517 R449H probably damaging Het
Cit A G 5: 115,984,822 H1384R possibly damaging Het
Cltc A G 11: 86,721,648 I524T probably benign Het
Dctn1 T A 6: 83,183,060 I94N probably damaging Het
Ddx58 T A 4: 40,206,034 I853F possibly damaging Het
Dnhd1 A T 7: 105,705,265 D3078V probably damaging Het
Dock7 G A 4: 99,055,446 P520S Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Eprs T A 1: 185,413,169 Y1130N probably damaging Het
Fcgrt T C 7: 45,095,373 T224A probably damaging Het
Flt1 T A 5: 147,700,367 T39S probably benign Het
Fxyd1 T C 7: 31,053,471 Y33C probably damaging Het
Gab2 T A 7: 97,301,426 V442E probably damaging Het
Ganab A G 19: 8,914,712 D800G probably benign Het
Gata4 C A 14: 63,240,737 A138S probably benign Het
Hist1h1t A G 13: 23,696,472 R203G possibly damaging Het
Htra4 A G 8: 25,037,077 V234A possibly damaging Het
Igkv4-74 A T 6: 69,184,970 Y72N probably damaging Het
Iqsec3 T C 6: 121,383,981 K973E probably damaging Het
Khdc1b C A 1: 21,384,841 T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Lrba T A 3: 86,318,167 V666E probably damaging Het
Mettl25 T A 10: 105,766,010 Y528F probably benign Het
Mms19 A T 19: 41,952,465 Y619* probably null Het
Nlrp12 A C 7: 3,228,388 probably null Het
Nol10 C T 12: 17,424,675 L623F possibly damaging Het
Oas1g A G 5: 120,886,000 F82S probably damaging Het
Olfr1537 G A 9: 39,238,250 P58L probably benign Het
Olfr195 C T 16: 59,149,207 A119V probably damaging Het
Olfr335-ps T G 2: 36,301,760 S74A probably benign Het
Oxr1 G A 15: 41,823,467 E582K probably damaging Het
Pdia3 A G 2: 121,432,357 D268G possibly damaging Het
Pramef12 T C 4: 144,392,864 S378G probably damaging Het
Rcor3 A G 1: 192,101,778 Y387H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Rsl1 T C 13: 67,182,220 L244P possibly damaging Het
Scn5a G T 9: 119,495,540 N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 A24V probably benign Het
Slc22a8 A G 19: 8,593,959 Y18C possibly damaging Het
Slc35d1 C T 4: 103,214,847 R7H probably damaging Het
Slco6d1 A T 1: 98,497,523 T599S probably damaging Het
St18 T A 1: 6,802,537 H165Q probably benign Het
Sub1 C T 15: 11,986,503 R86K probably damaging Het
Tectb G A 19: 55,192,672 V148M Het
Tgfb2 C A 1: 186,630,757 G290V possibly damaging Het
Tgm7 T C 2: 121,093,710 H577R probably benign Het
Tle2 T C 10: 81,587,147 S460P probably damaging Het
Tmem221 C A 8: 71,558,802 R3L possibly damaging Het
Tnfrsf19 C A 14: 60,974,734 V156L possibly damaging Het
Trav6-5 A G 14: 53,491,507 K75E probably benign Het
Trip10 G A 17: 57,262,442 G488S probably damaging Het
Usp34 A C 11: 23,449,268 K2419T Het
Vps13d T C 4: 145,075,052 Q3532R Het
Vps4a A T 8: 107,040,897 I163L probably damaging Het
Wrn T C 8: 33,324,426 H330R probably benign Het
Xpr1 T C 1: 155,312,872 I341V probably benign Het
Zfyve9 T C 4: 108,691,776 E105G probably benign Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118514271 critical splice donor site probably null
IGL00801:Golga4 APN 9 118538926 missense probably damaging 0.98
IGL01395:Golga4 APN 9 118535373 missense probably damaging 1.00
IGL01472:Golga4 APN 9 118532574 missense probably damaging 1.00
IGL01519:Golga4 APN 9 118527092 missense probably damaging 1.00
IGL01563:Golga4 APN 9 118527006 splice site probably benign
IGL02593:Golga4 APN 9 118555566 unclassified probably benign
IGL02803:Golga4 APN 9 118535460 missense probably benign
IGL02939:Golga4 APN 9 118535454 missense probably benign 0.01
IGL02939:Golga4 APN 9 118534632 missense probably damaging 1.00
IGL03123:Golga4 APN 9 118536885 missense probably damaging 1.00
IGL03334:Golga4 APN 9 118537233 splice site probably benign
F5770:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118553457 missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118553453 missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118560740 critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118568993 missense probably benign 0.00
R0362:Golga4 UTSW 9 118555785 missense probably benign 0.13
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0974:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R1128:Golga4 UTSW 9 118548784 missense probably benign 0.40
R1384:Golga4 UTSW 9 118565651 missense probably damaging 0.99
R1435:Golga4 UTSW 9 118535440 missense probably benign 0.00
R1513:Golga4 UTSW 9 118555732 missense probably benign 0.02
R1818:Golga4 UTSW 9 118572987 missense probably damaging 1.00
R2083:Golga4 UTSW 9 118532590 missense probably damaging 1.00
R2243:Golga4 UTSW 9 118556904 missense probably benign 0.06
R2355:Golga4 UTSW 9 118560742 missense probably benign 0.00
R2518:Golga4 UTSW 9 118556612 missense probably damaging 1.00
R2921:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118557380 missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118534647 missense probably benign 0.16
R3909:Golga4 UTSW 9 118558736 missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118538971 missense probably damaging 0.99
R4321:Golga4 UTSW 9 118556435 missense probably damaging 1.00
R4358:Golga4 UTSW 9 118551878 missense probably benign 0.16
R4483:Golga4 UTSW 9 118514186 missense probably damaging 1.00
R4515:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4518:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4519:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4545:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4546:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4580:Golga4 UTSW 9 118557259 missense probably benign 0.00
R4918:Golga4 UTSW 9 118558145 missense probably damaging 1.00
R5007:Golga4 UTSW 9 118558300 missense probably benign
R5045:Golga4 UTSW 9 118565656 missense probably benign
R5232:Golga4 UTSW 9 118506558 critical splice donor site probably null
R5256:Golga4 UTSW 9 118556501 missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118559057 nonsense probably null
R5567:Golga4 UTSW 9 118558183 missense probably damaging 1.00
R5576:Golga4 UTSW 9 118553534 missense probably benign 0.13
R5771:Golga4 UTSW 9 118558283 missense probably damaging 0.96
R5807:Golga4 UTSW 9 118527130 missense probably damaging 0.99
R5860:Golga4 UTSW 9 118558106 missense probably damaging 1.00
R6012:Golga4 UTSW 9 118559696 missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118558627 nonsense probably null
R6299:Golga4 UTSW 9 118557370 missense probably benign 0.03
R6467:Golga4 UTSW 9 118536792 missense probably damaging 1.00
R6552:Golga4 UTSW 9 118514231 missense probably damaging 1.00
R6688:Golga4 UTSW 9 118514210 missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118548779 missense probably damaging 1.00
R6987:Golga4 UTSW 9 118558532 missense probably benign
R7212:Golga4 UTSW 9 118536840 missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118559495 missense probably benign
R7431:Golga4 UTSW 9 118559731 missense probably damaging 1.00
R7641:Golga4 UTSW 9 118557575 missense probably benign 0.05
R7727:Golga4 UTSW 9 118548702 missense probably damaging 1.00
R7811:Golga4 UTSW 9 118532575 missense probably damaging 1.00
R7849:Golga4 UTSW 9 118559311 missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118556366 missense probably damaging 1.00
R7932:Golga4 UTSW 9 118559311 missense possibly damaging 0.93
R7974:Golga4 UTSW 9 118556366 missense probably damaging 1.00
RF022:Golga4 UTSW 9 118557989 missense probably damaging 1.00
V7583:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AAGACCTTGGAGAAGCTTGAC -3'
(R):5'- GCTCAGAGTGCAAGAGATCTAG -3'

Sequencing Primer
(F):5'- CCTTGGAGAAGCTTGACAAGAAG -3'
(R):5'- AGATCTAGTTTGGCCAAGGC -3'
Posted On2019-11-12