Incidental Mutation 'R7729:Golga4'
ID 595719
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
MMRRC Submission 045785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7729 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118385131 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 751 (H751R)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
AlphaFold Q91VW5
Predicted Effect possibly damaging
Transcript: ENSMUST00000084820
AA Change: H751R

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: H751R

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211840
Predicted Effect probably benign
Transcript: ENSMUST00000212097
AA Change: H723R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T G 2: 127,028,710 (GRCm39) D163A possibly damaging Het
Abce1 A T 8: 80,414,537 (GRCm39) I454N probably damaging Het
Acaca A G 11: 84,262,339 (GRCm39) I1980M probably damaging Het
Adgrb2 C T 4: 129,885,917 (GRCm39) T19M probably benign Het
Agmo T A 12: 37,464,974 (GRCm39) S417T probably benign Het
Akap8l T C 17: 32,552,068 (GRCm39) E403G probably damaging Het
Art5 C T 7: 101,747,711 (GRCm39) A23T possibly damaging Het
Atg9a T C 1: 75,161,204 (GRCm39) T681A probably benign Het
Atp11b A G 3: 35,832,256 (GRCm39) Q37R probably damaging Het
Atp2a2 T C 5: 122,629,829 (GRCm39) E80G probably benign Het
AW551984 G A 9: 39,511,071 (GRCm39) P172L possibly damaging Het
Bace1 C T 9: 45,769,743 (GRCm39) R296C probably damaging Het
Ccser1 T A 6: 61,288,840 (GRCm39) H334Q probably benign Het
Chtf18 C T 17: 25,942,491 (GRCm39) R449H probably damaging Het
Cit A G 5: 116,122,881 (GRCm39) H1384R possibly damaging Het
Cltc A G 11: 86,612,474 (GRCm39) I524T probably benign Het
Dctn1 T A 6: 83,160,042 (GRCm39) I94N probably damaging Het
Dnhd1 A T 7: 105,354,472 (GRCm39) D3078V probably damaging Het
Dock7 G A 4: 98,943,683 (GRCm39) P520S Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Eprs1 T A 1: 185,145,366 (GRCm39) Y1130N probably damaging Het
Fcgrt T C 7: 44,744,797 (GRCm39) T224A probably damaging Het
Flt1 T A 5: 147,637,177 (GRCm39) T39S probably benign Het
Fxyd1 T C 7: 30,752,896 (GRCm39) Y33C probably damaging Het
Gab2 T A 7: 96,950,633 (GRCm39) V442E probably damaging Het
Ganab A G 19: 8,892,076 (GRCm39) D800G probably benign Het
Gata4 C A 14: 63,478,186 (GRCm39) A138S probably benign Het
H1f6 A G 13: 23,880,455 (GRCm39) R203G possibly damaging Het
Htra4 A G 8: 25,527,093 (GRCm39) V234A possibly damaging Het
Igkv4-74 A T 6: 69,161,954 (GRCm39) Y72N probably damaging Het
Iqsec3 T C 6: 121,360,940 (GRCm39) K973E probably damaging Het
Khdc1b C A 1: 21,455,065 (GRCm39) T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 141,850,333 (GRCm39) probably benign Het
Kyat3 A G 3: 142,432,066 (GRCm39) probably null Het
Lrba T A 3: 86,225,474 (GRCm39) V666E probably damaging Het
Mettl25 T A 10: 105,601,871 (GRCm39) Y528F probably benign Het
Mms19 A T 19: 41,940,904 (GRCm39) Y619* probably null Het
Nlrp12 A C 7: 3,277,020 (GRCm39) probably null Het
Nol10 C T 12: 17,474,676 (GRCm39) L623F possibly damaging Het
Oas1g A G 5: 121,024,063 (GRCm39) F82S probably damaging Het
Or1j8 T G 2: 36,191,772 (GRCm39) S74A probably benign Het
Or5k3 C T 16: 58,969,570 (GRCm39) A119V probably damaging Het
Or8g18 G A 9: 39,149,546 (GRCm39) P58L probably benign Het
Oxr1 G A 15: 41,686,863 (GRCm39) E582K probably damaging Het
Pdia3 A G 2: 121,262,838 (GRCm39) D268G possibly damaging Het
Pramel13 T C 4: 144,119,434 (GRCm39) S378G probably damaging Het
Rcor3 A G 1: 191,786,078 (GRCm39) Y387H probably damaging Het
Rigi T A 4: 40,206,034 (GRCm39) I853F possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,118 (GRCm39) probably benign Het
Rsl1 T C 13: 67,330,284 (GRCm39) L244P possibly damaging Het
Scn5a G T 9: 119,324,606 (GRCm39) N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 (GRCm39) A24V probably benign Het
Slc22a8 A G 19: 8,571,323 (GRCm39) Y18C possibly damaging Het
Slc35d1 C T 4: 103,072,044 (GRCm39) R7H probably damaging Het
Slco6d1 A T 1: 98,425,248 (GRCm39) T599S probably damaging Het
Spata31d1e C T 13: 59,889,437 (GRCm39) M794I not run Het
St18 T A 1: 6,872,761 (GRCm39) H165Q probably benign Het
Sub1 C T 15: 11,986,589 (GRCm39) R86K probably damaging Het
Tectb G A 19: 55,181,104 (GRCm39) V148M Het
Tgfb2 C A 1: 186,362,954 (GRCm39) G290V possibly damaging Het
Tgm7 T C 2: 120,924,191 (GRCm39) H577R probably benign Het
Tle2 T C 10: 81,422,981 (GRCm39) S460P probably damaging Het
Tmem221 C A 8: 72,011,446 (GRCm39) R3L possibly damaging Het
Tnfrsf19 C A 14: 61,212,183 (GRCm39) V156L possibly damaging Het
Trav6-5 A G 14: 53,728,964 (GRCm39) K75E probably benign Het
Trip10 G A 17: 57,569,442 (GRCm39) G488S probably damaging Het
Usp34 A C 11: 23,399,268 (GRCm39) K2419T Het
Vps13d T C 4: 144,801,622 (GRCm39) Q3532R Het
Vps4a A T 8: 107,767,529 (GRCm39) I163L probably damaging Het
Wrn T C 8: 33,814,454 (GRCm39) H330R probably benign Het
Xpr1 T C 1: 155,188,618 (GRCm39) I341V probably benign Het
Zfyve9 T C 4: 108,548,973 (GRCm39) E105G probably benign Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118,382,521 (GRCm39) missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118,389,808 (GRCm39) critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R1818:Golga4 UTSW 9 118,402,055 (GRCm39) missense probably damaging 1.00
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4519:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4546:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4580:Golga4 UTSW 9 118,386,327 (GRCm39) missense probably benign 0.00
R4918:Golga4 UTSW 9 118,387,213 (GRCm39) missense probably damaging 1.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5567:Golga4 UTSW 9 118,387,251 (GRCm39) missense probably damaging 1.00
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118,387,695 (GRCm39) nonsense probably null
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7212:Golga4 UTSW 9 118,365,908 (GRCm39) missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118,388,563 (GRCm39) missense probably benign
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R8856:Golga4 UTSW 9 118,385,779 (GRCm39) missense probably damaging 0.98
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AAGACCTTGGAGAAGCTTGAC -3'
(R):5'- GCTCAGAGTGCAAGAGATCTAG -3'

Sequencing Primer
(F):5'- CCTTGGAGAAGCTTGACAAGAAG -3'
(R):5'- AGATCTAGTTTGGCCAAGGC -3'
Posted On 2019-11-12