Incidental Mutation 'R7729:Nol10'
ID 595726
Institutional Source Beutler Lab
Gene Symbol Nol10
Ensembl Gene ENSMUSG00000061458
Gene Name nucleolar protein 10
Synonyms LOC217431
MMRRC Submission 045785-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.969) question?
Stock # R7729 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 17398459-17480096 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 17474676 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 623 (L623F)
Ref Sequence ENSEMBL: ENSMUSP00000035930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046011]
AlphaFold Q5RJG1
Predicted Effect possibly damaging
Transcript: ENSMUST00000046011
AA Change: L623F

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035930
Gene: ENSMUSG00000061458
AA Change: L623F

DomainStartEndE-ValueType
WD40 42 81 1.1e1 SMART
Blast:WD40 84 123 1e-8 BLAST
WD40 165 204 3.3e1 SMART
WD40 223 257 4.42e1 SMART
WD40 260 299 1.19e1 SMART
WD40 302 340 1.97e2 SMART
low complexity region 451 476 N/A INTRINSIC
Pfam:NUC153 482 509 1.4e-15 PFAM
low complexity region 515 536 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
coiled coil region 557 588 N/A INTRINSIC
low complexity region 650 660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T G 2: 127,028,710 (GRCm39) D163A possibly damaging Het
Abce1 A T 8: 80,414,537 (GRCm39) I454N probably damaging Het
Acaca A G 11: 84,262,339 (GRCm39) I1980M probably damaging Het
Adgrb2 C T 4: 129,885,917 (GRCm39) T19M probably benign Het
Agmo T A 12: 37,464,974 (GRCm39) S417T probably benign Het
Akap8l T C 17: 32,552,068 (GRCm39) E403G probably damaging Het
Art5 C T 7: 101,747,711 (GRCm39) A23T possibly damaging Het
Atg9a T C 1: 75,161,204 (GRCm39) T681A probably benign Het
Atp11b A G 3: 35,832,256 (GRCm39) Q37R probably damaging Het
Atp2a2 T C 5: 122,629,829 (GRCm39) E80G probably benign Het
AW551984 G A 9: 39,511,071 (GRCm39) P172L possibly damaging Het
Bace1 C T 9: 45,769,743 (GRCm39) R296C probably damaging Het
Ccser1 T A 6: 61,288,840 (GRCm39) H334Q probably benign Het
Chtf18 C T 17: 25,942,491 (GRCm39) R449H probably damaging Het
Cit A G 5: 116,122,881 (GRCm39) H1384R possibly damaging Het
Cltc A G 11: 86,612,474 (GRCm39) I524T probably benign Het
Dctn1 T A 6: 83,160,042 (GRCm39) I94N probably damaging Het
Dnhd1 A T 7: 105,354,472 (GRCm39) D3078V probably damaging Het
Dock7 G A 4: 98,943,683 (GRCm39) P520S Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Eprs1 T A 1: 185,145,366 (GRCm39) Y1130N probably damaging Het
Fcgrt T C 7: 44,744,797 (GRCm39) T224A probably damaging Het
Flt1 T A 5: 147,637,177 (GRCm39) T39S probably benign Het
Fxyd1 T C 7: 30,752,896 (GRCm39) Y33C probably damaging Het
Gab2 T A 7: 96,950,633 (GRCm39) V442E probably damaging Het
Ganab A G 19: 8,892,076 (GRCm39) D800G probably benign Het
Gata4 C A 14: 63,478,186 (GRCm39) A138S probably benign Het
Golga4 A G 9: 118,385,131 (GRCm39) H751R possibly damaging Het
H1f6 A G 13: 23,880,455 (GRCm39) R203G possibly damaging Het
Htra4 A G 8: 25,527,093 (GRCm39) V234A possibly damaging Het
Igkv4-74 A T 6: 69,161,954 (GRCm39) Y72N probably damaging Het
Iqsec3 T C 6: 121,360,940 (GRCm39) K973E probably damaging Het
Khdc1b C A 1: 21,455,065 (GRCm39) T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 141,850,333 (GRCm39) probably benign Het
Kyat3 A G 3: 142,432,066 (GRCm39) probably null Het
Lrba T A 3: 86,225,474 (GRCm39) V666E probably damaging Het
Mettl25 T A 10: 105,601,871 (GRCm39) Y528F probably benign Het
Mms19 A T 19: 41,940,904 (GRCm39) Y619* probably null Het
Nlrp12 A C 7: 3,277,020 (GRCm39) probably null Het
Oas1g A G 5: 121,024,063 (GRCm39) F82S probably damaging Het
Or1j8 T G 2: 36,191,772 (GRCm39) S74A probably benign Het
Or5k3 C T 16: 58,969,570 (GRCm39) A119V probably damaging Het
Or8g18 G A 9: 39,149,546 (GRCm39) P58L probably benign Het
Oxr1 G A 15: 41,686,863 (GRCm39) E582K probably damaging Het
Pdia3 A G 2: 121,262,838 (GRCm39) D268G possibly damaging Het
Pramel13 T C 4: 144,119,434 (GRCm39) S378G probably damaging Het
Rcor3 A G 1: 191,786,078 (GRCm39) Y387H probably damaging Het
Rigi T A 4: 40,206,034 (GRCm39) I853F possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,118 (GRCm39) probably benign Het
Rsl1 T C 13: 67,330,284 (GRCm39) L244P possibly damaging Het
Scn5a G T 9: 119,324,606 (GRCm39) N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 (GRCm39) A24V probably benign Het
Slc22a8 A G 19: 8,571,323 (GRCm39) Y18C possibly damaging Het
Slc35d1 C T 4: 103,072,044 (GRCm39) R7H probably damaging Het
Slco6d1 A T 1: 98,425,248 (GRCm39) T599S probably damaging Het
Spata31d1e C T 13: 59,889,437 (GRCm39) M794I not run Het
St18 T A 1: 6,872,761 (GRCm39) H165Q probably benign Het
Sub1 C T 15: 11,986,589 (GRCm39) R86K probably damaging Het
Tectb G A 19: 55,181,104 (GRCm39) V148M Het
Tgfb2 C A 1: 186,362,954 (GRCm39) G290V possibly damaging Het
Tgm7 T C 2: 120,924,191 (GRCm39) H577R probably benign Het
Tle2 T C 10: 81,422,981 (GRCm39) S460P probably damaging Het
Tmem221 C A 8: 72,011,446 (GRCm39) R3L possibly damaging Het
Tnfrsf19 C A 14: 61,212,183 (GRCm39) V156L possibly damaging Het
Trav6-5 A G 14: 53,728,964 (GRCm39) K75E probably benign Het
Trip10 G A 17: 57,569,442 (GRCm39) G488S probably damaging Het
Usp34 A C 11: 23,399,268 (GRCm39) K2419T Het
Vps13d T C 4: 144,801,622 (GRCm39) Q3532R Het
Vps4a A T 8: 107,767,529 (GRCm39) I163L probably damaging Het
Wrn T C 8: 33,814,454 (GRCm39) H330R probably benign Het
Xpr1 T C 1: 155,188,618 (GRCm39) I341V probably benign Het
Zfyve9 T C 4: 108,548,973 (GRCm39) E105G probably benign Het
Other mutations in Nol10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Nol10 APN 12 17,411,130 (GRCm39) splice site probably benign
R1769:Nol10 UTSW 12 17,466,709 (GRCm39) splice site probably benign
R1884:Nol10 UTSW 12 17,418,390 (GRCm39) critical splice donor site probably null
R1930:Nol10 UTSW 12 17,398,555 (GRCm39) start codon destroyed probably null 0.99
R1931:Nol10 UTSW 12 17,398,555 (GRCm39) start codon destroyed probably null 0.99
R2010:Nol10 UTSW 12 17,466,102 (GRCm39) missense probably benign 0.00
R2037:Nol10 UTSW 12 17,411,152 (GRCm39) missense probably benign 0.01
R2168:Nol10 UTSW 12 17,423,585 (GRCm39) missense probably damaging 1.00
R3729:Nol10 UTSW 12 17,474,674 (GRCm39) missense probably benign 0.42
R3731:Nol10 UTSW 12 17,474,674 (GRCm39) missense probably benign 0.42
R4368:Nol10 UTSW 12 17,429,293 (GRCm39) missense probably damaging 1.00
R4618:Nol10 UTSW 12 17,398,562 (GRCm39) missense probably damaging 0.98
R4736:Nol10 UTSW 12 17,405,288 (GRCm39) missense probably damaging 1.00
R5342:Nol10 UTSW 12 17,419,621 (GRCm39) splice site probably null
R5451:Nol10 UTSW 12 17,409,103 (GRCm39) nonsense probably null
R5536:Nol10 UTSW 12 17,466,138 (GRCm39) nonsense probably null
R5586:Nol10 UTSW 12 17,466,829 (GRCm39) missense possibly damaging 0.73
R6045:Nol10 UTSW 12 17,398,479 (GRCm39) start gained probably benign
R6833:Nol10 UTSW 12 17,402,728 (GRCm39) missense probably benign 0.03
R7039:Nol10 UTSW 12 17,479,185 (GRCm39) missense possibly damaging 0.94
R7189:Nol10 UTSW 12 17,423,562 (GRCm39) critical splice acceptor site probably null
R7251:Nol10 UTSW 12 17,452,108 (GRCm39) missense probably damaging 1.00
R7399:Nol10 UTSW 12 17,452,174 (GRCm39) missense probably damaging 1.00
R7600:Nol10 UTSW 12 17,419,481 (GRCm39) missense probably damaging 0.99
R7650:Nol10 UTSW 12 17,412,683 (GRCm39) critical splice donor site probably null
R7772:Nol10 UTSW 12 17,398,586 (GRCm39) missense probably damaging 1.00
R7869:Nol10 UTSW 12 17,408,239 (GRCm39) missense probably null 0.93
R7972:Nol10 UTSW 12 17,402,648 (GRCm39) missense probably benign 0.15
R8686:Nol10 UTSW 12 17,419,772 (GRCm39) intron probably benign
R8926:Nol10 UTSW 12 17,466,871 (GRCm39) missense probably benign 0.00
R8936:Nol10 UTSW 12 17,466,863 (GRCm39) missense probably benign 0.08
R8966:Nol10 UTSW 12 17,419,507 (GRCm39) missense possibly damaging 0.64
R8994:Nol10 UTSW 12 17,402,717 (GRCm39) missense probably damaging 1.00
R9002:Nol10 UTSW 12 17,408,134 (GRCm39) missense probably damaging 1.00
R9096:Nol10 UTSW 12 17,466,199 (GRCm39) missense probably benign
R9196:Nol10 UTSW 12 17,455,316 (GRCm39) missense probably benign 0.04
R9548:Nol10 UTSW 12 17,466,144 (GRCm39) missense possibly damaging 0.49
Z1177:Nol10 UTSW 12 17,409,089 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATGACAGTTTGAGGGCAGCTG -3'
(R):5'- CTCTGGCTATAGGAAACACTGG -3'

Sequencing Primer
(F):5'- GACTCTGGGCTCTGCTAGACAAG -3'
(R):5'- CTGGAGTAGGGAACACAGCTTTCTC -3'
Posted On 2019-11-12