Incidental Mutation 'R7729:Gata4'
ID595733
Institutional Source Beutler Lab
Gene Symbol Gata4
Ensembl Gene ENSMUSG00000021944
Gene NameGATA binding protein 4
SynonymsGata-4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7729 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location63198922-63271692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63240737 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 138 (A138S)
Ref Sequence ENSEMBL: ENSMUSP00000066927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067417] [ENSMUST00000118022] [ENSMUST00000132122] [ENSMUST00000137244] [ENSMUST00000156782]
Predicted Effect probably benign
Transcript: ENSMUST00000067417
AA Change: A138S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066927
Gene: ENSMUSG00000021944
AA Change: A138S

DomainStartEndE-ValueType
Pfam:GATA-N 1 204 2.2e-54 PFAM
ZnF_GATA 211 261 4.36e-18 SMART
ZnF_GATA 265 315 1.02e-23 SMART
low complexity region 342 360 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118022
AA Change: A138S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113891
Gene: ENSMUSG00000021944
AA Change: A138S

DomainStartEndE-ValueType
Pfam:GATA-N 1 207 7.8e-54 PFAM
ZnF_GATA 210 260 4.36e-18 SMART
ZnF_GATA 264 314 1.02e-23 SMART
low complexity region 341 359 N/A INTRINSIC
low complexity region 372 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132122
Predicted Effect probably benign
Transcript: ENSMUST00000137244
Predicted Effect probably benign
Transcript: ENSMUST00000156782
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GATA family of zinc-finger transcription factors. Members of this family recognize the GATA motif which is present in the promoters of many genes. This protein is thought to regulate genes involved in embryogenesis and in myocardial differentiation and function, and is necessary for normal testicular development. Mutations in this gene have been associated with cardiac septal defects. Additionally, alterations in gene expression have been associated with several cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in ventral morphogenesis, lack a primitive heart tube and foregut, develop partially outside the yolk sac, and die by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,623 M794I not run Het
1810024B03Rik T G 2: 127,186,790 D163A possibly damaging Het
Abce1 A T 8: 79,687,908 I454N probably damaging Het
Acaca A G 11: 84,371,513 I1980M probably damaging Het
Adgrb2 C T 4: 129,992,124 T19M probably benign Het
Agmo T A 12: 37,414,975 S417T probably benign Het
Akap8l T C 17: 32,333,094 E403G probably damaging Het
Art5 C T 7: 102,098,504 A23T possibly damaging Het
Atg9a T C 1: 75,184,560 T681A probably benign Het
Atp11b A G 3: 35,778,107 Q37R probably damaging Het
Atp2a2 T C 5: 122,491,766 E80G probably benign Het
AW551984 G A 9: 39,599,775 P172L possibly damaging Het
Bace1 C T 9: 45,858,445 R296C probably damaging Het
Ccser1 T A 6: 61,311,856 H334Q probably benign Het
Chtf18 C T 17: 25,723,517 R449H probably damaging Het
Cit A G 5: 115,984,822 H1384R possibly damaging Het
Cltc A G 11: 86,721,648 I524T probably benign Het
Dctn1 T A 6: 83,183,060 I94N probably damaging Het
Ddx58 T A 4: 40,206,034 I853F possibly damaging Het
Dnhd1 A T 7: 105,705,265 D3078V probably damaging Het
Dock7 G A 4: 99,055,446 P520S Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Eprs T A 1: 185,413,169 Y1130N probably damaging Het
Fcgrt T C 7: 45,095,373 T224A probably damaging Het
Flt1 T A 5: 147,700,367 T39S probably benign Het
Fxyd1 T C 7: 31,053,471 Y33C probably damaging Het
Gab2 T A 7: 97,301,426 V442E probably damaging Het
Ganab A G 19: 8,914,712 D800G probably benign Het
Golga4 A G 9: 118,556,063 H751R possibly damaging Het
Hist1h1t A G 13: 23,696,472 R203G possibly damaging Het
Htra4 A G 8: 25,037,077 V234A possibly damaging Het
Igkv4-74 A T 6: 69,184,970 Y72N probably damaging Het
Iqsec3 T C 6: 121,383,981 K973E probably damaging Het
Khdc1b C A 1: 21,384,841 T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Lrba T A 3: 86,318,167 V666E probably damaging Het
Mettl25 T A 10: 105,766,010 Y528F probably benign Het
Mms19 A T 19: 41,952,465 Y619* probably null Het
Nlrp12 A C 7: 3,228,388 probably null Het
Nol10 C T 12: 17,424,675 L623F possibly damaging Het
Oas1g A G 5: 120,886,000 F82S probably damaging Het
Olfr1537 G A 9: 39,238,250 P58L probably benign Het
Olfr195 C T 16: 59,149,207 A119V probably damaging Het
Olfr335-ps T G 2: 36,301,760 S74A probably benign Het
Oxr1 G A 15: 41,823,467 E582K probably damaging Het
Pdia3 A G 2: 121,432,357 D268G possibly damaging Het
Pramef12 T C 4: 144,392,864 S378G probably damaging Het
Rcor3 A G 1: 192,101,778 Y387H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Rsl1 T C 13: 67,182,220 L244P possibly damaging Het
Scn5a G T 9: 119,495,540 N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 A24V probably benign Het
Slc22a8 A G 19: 8,593,959 Y18C possibly damaging Het
Slc35d1 C T 4: 103,214,847 R7H probably damaging Het
Slco6d1 A T 1: 98,497,523 T599S probably damaging Het
St18 T A 1: 6,802,537 H165Q probably benign Het
Sub1 C T 15: 11,986,503 R86K probably damaging Het
Tectb G A 19: 55,192,672 V148M Het
Tgfb2 C A 1: 186,630,757 G290V possibly damaging Het
Tgm7 T C 2: 121,093,710 H577R probably benign Het
Tle2 T C 10: 81,587,147 S460P probably damaging Het
Tmem221 C A 8: 71,558,802 R3L possibly damaging Het
Tnfrsf19 C A 14: 60,974,734 V156L possibly damaging Het
Trav6-5 A G 14: 53,491,507 K75E probably benign Het
Trip10 G A 17: 57,262,442 G488S probably damaging Het
Usp34 A C 11: 23,449,268 K2419T Het
Vps13d T C 4: 145,075,052 Q3532R Het
Vps4a A T 8: 107,040,897 I163L probably damaging Het
Wrn T C 8: 33,324,426 H330R probably benign Het
Xpr1 T C 1: 155,312,872 I341V probably benign Het
Zfyve9 T C 4: 108,691,776 E105G probably benign Het
Other mutations in Gata4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Gata4 APN 14 63200463 missense possibly damaging 0.53
IGL02481:Gata4 APN 14 63200461 missense probably benign 0.01
IGL02483:Gata4 APN 14 63200461 missense probably benign 0.01
IGL02643:Gata4 APN 14 63204755 missense possibly damaging 0.85
R0034:Gata4 UTSW 14 63201484 missense probably benign 0.00
R0043:Gata4 UTSW 14 63203301 splice site probably benign
R1131:Gata4 UTSW 14 63204740 missense possibly damaging 0.71
R1880:Gata4 UTSW 14 63204695 missense probably damaging 1.00
R3500:Gata4 UTSW 14 63200533 missense possibly damaging 0.84
R3949:Gata4 UTSW 14 63240697 missense possibly damaging 0.95
R4893:Gata4 UTSW 14 63201596 missense probably benign 0.01
R4976:Gata4 UTSW 14 63203689 missense probably damaging 1.00
R5152:Gata4 UTSW 14 63241121 missense probably damaging 1.00
R5198:Gata4 UTSW 14 63200451 missense probably benign 0.09
R5237:Gata4 UTSW 14 63240626 missense probably benign 0.28
R5291:Gata4 UTSW 14 63240599 missense probably damaging 0.98
R5358:Gata4 UTSW 14 63240626 missense probably benign 0.28
R5693:Gata4 UTSW 14 63241145 missense probably damaging 1.00
R7143:Gata4 UTSW 14 63204617 missense probably damaging 1.00
R7299:Gata4 UTSW 14 63203742 missense probably damaging 1.00
R7849:Gata4 UTSW 14 63204725 missense possibly damaging 0.92
R7932:Gata4 UTSW 14 63204725 missense possibly damaging 0.92
Z1177:Gata4 UTSW 14 63200382 missense probably damaging 0.99
Z1177:Gata4 UTSW 14 63241265 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTAACTCACCGAGATTGGGG -3'
(R):5'- TTGGGGCGATGTACCAAAG -3'

Sequencing Primer
(F):5'- CACCGAGATTGGGGTGTCTTCC -3'
(R):5'- TGCAGCTGGAACCACCTC -3'
Posted On2019-11-12