Incidental Mutation 'R7729:Chtf18'
ID 595737
Institutional Source Beutler Lab
Gene Symbol Chtf18
Ensembl Gene ENSMUSG00000019214
Gene Name CTF18, chromosome transmission fidelity factor 18
Synonyms CTF18, 6030457M03Rik
MMRRC Submission 045785-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.338) question?
Stock # R7729 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 25938004-25946409 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 25942491 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 449 (R449H)
Ref Sequence ENSEMBL: ENSMUSP00000043896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047273] [ENSMUST00000048054] [ENSMUST00000115108] [ENSMUST00000167940] [ENSMUST00000170070] [ENSMUST00000170575] [ENSMUST00000172002]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000047273
SMART Domains Protein: ENSMUSP00000043825
Gene: ENSMUSG00000041199

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 17 182 4.1e-27 PFAM
low complexity region 271 287 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000048054
AA Change: R449H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043896
Gene: ENSMUSG00000019214
AA Change: R449H

DomainStartEndE-ValueType
low complexity region 20 30 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 117 130 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 228 255 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
AAA 361 518 1.99e-11 SMART
low complexity region 646 661 N/A INTRINSIC
Blast:AAA 728 850 7e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115108
SMART Domains Protein: ENSMUSP00000110760
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167940
SMART Domains Protein: ENSMUSP00000131349
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Blast:AAA 21 107 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169767
Predicted Effect probably benign
Transcript: ENSMUST00000170070
SMART Domains Protein: ENSMUSP00000131768
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170575
SMART Domains Protein: ENSMUSP00000131366
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172002
SMART Domains Protein: ENSMUSP00000131648
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a component of a replication factor C (RFC) complex, which loads proliferating cell nuclear antigen (PCNA) on to DNA during the S phase of cell cycle. The encoded protein may interact with other proteins, including RFC complex 3, to form a clamp loader complex that plays a role in sister chromatid cohesion during metaphase-anaphase transition. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, reduced body and testis weight, defective male meiosis, impaired spermatogenesis, oligozoospermia, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T G 2: 127,028,710 (GRCm39) D163A possibly damaging Het
Abce1 A T 8: 80,414,537 (GRCm39) I454N probably damaging Het
Acaca A G 11: 84,262,339 (GRCm39) I1980M probably damaging Het
Adgrb2 C T 4: 129,885,917 (GRCm39) T19M probably benign Het
Agmo T A 12: 37,464,974 (GRCm39) S417T probably benign Het
Akap8l T C 17: 32,552,068 (GRCm39) E403G probably damaging Het
Art5 C T 7: 101,747,711 (GRCm39) A23T possibly damaging Het
Atg9a T C 1: 75,161,204 (GRCm39) T681A probably benign Het
Atp11b A G 3: 35,832,256 (GRCm39) Q37R probably damaging Het
Atp2a2 T C 5: 122,629,829 (GRCm39) E80G probably benign Het
AW551984 G A 9: 39,511,071 (GRCm39) P172L possibly damaging Het
Bace1 C T 9: 45,769,743 (GRCm39) R296C probably damaging Het
Ccser1 T A 6: 61,288,840 (GRCm39) H334Q probably benign Het
Cit A G 5: 116,122,881 (GRCm39) H1384R possibly damaging Het
Cltc A G 11: 86,612,474 (GRCm39) I524T probably benign Het
Dctn1 T A 6: 83,160,042 (GRCm39) I94N probably damaging Het
Dnhd1 A T 7: 105,354,472 (GRCm39) D3078V probably damaging Het
Dock7 G A 4: 98,943,683 (GRCm39) P520S Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Eprs1 T A 1: 185,145,366 (GRCm39) Y1130N probably damaging Het
Fcgrt T C 7: 44,744,797 (GRCm39) T224A probably damaging Het
Flt1 T A 5: 147,637,177 (GRCm39) T39S probably benign Het
Fxyd1 T C 7: 30,752,896 (GRCm39) Y33C probably damaging Het
Gab2 T A 7: 96,950,633 (GRCm39) V442E probably damaging Het
Ganab A G 19: 8,892,076 (GRCm39) D800G probably benign Het
Gata4 C A 14: 63,478,186 (GRCm39) A138S probably benign Het
Golga4 A G 9: 118,385,131 (GRCm39) H751R possibly damaging Het
H1f6 A G 13: 23,880,455 (GRCm39) R203G possibly damaging Het
Htra4 A G 8: 25,527,093 (GRCm39) V234A possibly damaging Het
Igkv4-74 A T 6: 69,161,954 (GRCm39) Y72N probably damaging Het
Iqsec3 T C 6: 121,360,940 (GRCm39) K973E probably damaging Het
Khdc1b C A 1: 21,455,065 (GRCm39) T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 141,850,333 (GRCm39) probably benign Het
Kyat3 A G 3: 142,432,066 (GRCm39) probably null Het
Lrba T A 3: 86,225,474 (GRCm39) V666E probably damaging Het
Mettl25 T A 10: 105,601,871 (GRCm39) Y528F probably benign Het
Mms19 A T 19: 41,940,904 (GRCm39) Y619* probably null Het
Nlrp12 A C 7: 3,277,020 (GRCm39) probably null Het
Nol10 C T 12: 17,474,676 (GRCm39) L623F possibly damaging Het
Oas1g A G 5: 121,024,063 (GRCm39) F82S probably damaging Het
Or1j8 T G 2: 36,191,772 (GRCm39) S74A probably benign Het
Or5k3 C T 16: 58,969,570 (GRCm39) A119V probably damaging Het
Or8g18 G A 9: 39,149,546 (GRCm39) P58L probably benign Het
Oxr1 G A 15: 41,686,863 (GRCm39) E582K probably damaging Het
Pdia3 A G 2: 121,262,838 (GRCm39) D268G possibly damaging Het
Pramel13 T C 4: 144,119,434 (GRCm39) S378G probably damaging Het
Rcor3 A G 1: 191,786,078 (GRCm39) Y387H probably damaging Het
Rigi T A 4: 40,206,034 (GRCm39) I853F possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,118 (GRCm39) probably benign Het
Rsl1 T C 13: 67,330,284 (GRCm39) L244P possibly damaging Het
Scn5a G T 9: 119,324,606 (GRCm39) N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 (GRCm39) A24V probably benign Het
Slc22a8 A G 19: 8,571,323 (GRCm39) Y18C possibly damaging Het
Slc35d1 C T 4: 103,072,044 (GRCm39) R7H probably damaging Het
Slco6d1 A T 1: 98,425,248 (GRCm39) T599S probably damaging Het
Spata31d1e C T 13: 59,889,437 (GRCm39) M794I not run Het
St18 T A 1: 6,872,761 (GRCm39) H165Q probably benign Het
Sub1 C T 15: 11,986,589 (GRCm39) R86K probably damaging Het
Tectb G A 19: 55,181,104 (GRCm39) V148M Het
Tgfb2 C A 1: 186,362,954 (GRCm39) G290V possibly damaging Het
Tgm7 T C 2: 120,924,191 (GRCm39) H577R probably benign Het
Tle2 T C 10: 81,422,981 (GRCm39) S460P probably damaging Het
Tmem221 C A 8: 72,011,446 (GRCm39) R3L possibly damaging Het
Tnfrsf19 C A 14: 61,212,183 (GRCm39) V156L possibly damaging Het
Trav6-5 A G 14: 53,728,964 (GRCm39) K75E probably benign Het
Trip10 G A 17: 57,569,442 (GRCm39) G488S probably damaging Het
Usp34 A C 11: 23,399,268 (GRCm39) K2419T Het
Vps13d T C 4: 144,801,622 (GRCm39) Q3532R Het
Vps4a A T 8: 107,767,529 (GRCm39) I163L probably damaging Het
Wrn T C 8: 33,814,454 (GRCm39) H330R probably benign Het
Xpr1 T C 1: 155,188,618 (GRCm39) I341V probably benign Het
Zfyve9 T C 4: 108,548,973 (GRCm39) E105G probably benign Het
Other mutations in Chtf18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Chtf18 APN 17 25,941,090 (GRCm39) missense probably benign 0.32
IGL02117:Chtf18 APN 17 25,941,177 (GRCm39) missense possibly damaging 0.63
IGL03034:Chtf18 APN 17 25,946,320 (GRCm39) utr 5 prime probably benign
IGL03051:Chtf18 APN 17 25,939,938 (GRCm39) missense probably damaging 1.00
IGL03164:Chtf18 APN 17 25,945,816 (GRCm39) missense probably benign 0.24
R0046:Chtf18 UTSW 17 25,942,434 (GRCm39) missense probably benign 0.06
R0129:Chtf18 UTSW 17 25,946,285 (GRCm39) nonsense probably null
R1122:Chtf18 UTSW 17 25,943,597 (GRCm39) missense probably damaging 1.00
R1302:Chtf18 UTSW 17 25,938,132 (GRCm39) missense probably damaging 1.00
R1487:Chtf18 UTSW 17 25,939,583 (GRCm39) missense probably benign 0.00
R1614:Chtf18 UTSW 17 25,946,064 (GRCm39) missense probably benign 0.00
R1820:Chtf18 UTSW 17 25,944,913 (GRCm39) missense probably damaging 1.00
R4051:Chtf18 UTSW 17 25,938,168 (GRCm39) missense probably damaging 0.98
R4357:Chtf18 UTSW 17 25,938,106 (GRCm39) missense probably benign 0.09
R4529:Chtf18 UTSW 17 25,939,592 (GRCm39) missense probably damaging 1.00
R4804:Chtf18 UTSW 17 25,938,231 (GRCm39) missense probably benign
R4975:Chtf18 UTSW 17 25,943,540 (GRCm39) missense possibly damaging 0.72
R5154:Chtf18 UTSW 17 25,942,694 (GRCm39) missense probably damaging 1.00
R6113:Chtf18 UTSW 17 25,941,841 (GRCm39) missense probably damaging 1.00
R6118:Chtf18 UTSW 17 25,938,133 (GRCm39) missense probably damaging 1.00
R6446:Chtf18 UTSW 17 25,940,218 (GRCm39) missense probably benign 0.01
R7057:Chtf18 UTSW 17 25,940,100 (GRCm39) missense possibly damaging 0.49
R7095:Chtf18 UTSW 17 25,941,652 (GRCm39) missense probably damaging 1.00
R7482:Chtf18 UTSW 17 25,938,963 (GRCm39) missense possibly damaging 0.48
R7641:Chtf18 UTSW 17 25,941,249 (GRCm39) splice site probably null
R7939:Chtf18 UTSW 17 25,941,111 (GRCm39) missense probably damaging 0.99
R8007:Chtf18 UTSW 17 25,944,508 (GRCm39) missense probably damaging 0.96
R8051:Chtf18 UTSW 17 25,942,453 (GRCm39) missense probably benign 0.05
R8296:Chtf18 UTSW 17 25,941,165 (GRCm39) missense probably benign 0.00
R8321:Chtf18 UTSW 17 25,939,865 (GRCm39) missense probably benign 0.32
R8433:Chtf18 UTSW 17 25,945,918 (GRCm39) missense probably benign
R9386:Chtf18 UTSW 17 25,942,732 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTGAACCTGCAGAACAG -3'
(R):5'- ACGCAAATGGAGTCGGTTC -3'

Sequencing Primer
(F):5'- CAGAACAGGACCTGCGGTG -3'
(R):5'- CAAATGGAGTCGGTTCTGGGTG -3'
Posted On 2019-11-12