Incidental Mutation 'R7730:Myog'
ID595745
Institutional Source Beutler Lab
Gene Symbol Myog
Ensembl Gene ENSMUSG00000026459
Gene Namemyogenin
Synonymsmyo, bHLHc3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location134289989-134292548 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 134291176 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027730]
Predicted Effect probably null
Transcript: ENSMUST00000027730
SMART Domains Protein: ENSMUSP00000027730
Gene: ENSMUSG00000026459

DomainStartEndE-ValueType
BASIC 1 86 7.02e-46 SMART
HLH 87 138 3.43e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myogenin is a muscle-specific transcription factor that can induce myogenesis in a variety of cell types in tissue culture. It is a member of a large family of proteins related by sequence homology, the helix-loop-helix (HLH) proteins. It is essential for the development of functional skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a severe reduction in muscle mass associated with delayed primary myogenesis and very little secondary myofiber formation, defects of the thoracic skeleton, and perinatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Myog
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0013:Myog UTSW 1 134290235 missense probably damaging 0.99
R0013:Myog UTSW 1 134290235 missense probably damaging 0.99
R0533:Myog UTSW 1 134290473 missense possibly damaging 0.82
R5309:Myog UTSW 1 134290326 missense probably damaging 0.99
R5312:Myog UTSW 1 134290326 missense probably damaging 0.99
R6455:Myog UTSW 1 134290488 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GCAAAGTTCTCATCCTAGAAGC -3'
(R):5'- TTTAGCTGGTCAAGGCTACCG -3'

Sequencing Primer
(F):5'- TGGTAACATTCTAGGGTAGGCAAC -3'
(R):5'- TCAGGTCAGCAAGTTCCT -3'
Posted On2019-11-12