Incidental Mutation 'R7730:Kcnt2'
ID595746
Institutional Source Beutler Lab
Gene Symbol Kcnt2
Ensembl Gene ENSMUSG00000052726
Gene Namepotassium channel, subfamily T, member 2
SynonymsE330038N15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location140246158-140612067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140518948 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 694 (F694I)
Ref Sequence ENSEMBL: ENSMUSP00000113333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]
Predicted Effect probably benign
Transcript: ENSMUST00000119786
AA Change: F644I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: F644I

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.6e-15 PFAM
Pfam:BK_channel_a 422 476 2.3e-16 PFAM
low complexity region 598 613 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120709
AA Change: F694I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: F694I

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.7e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
low complexity region 749 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120796
AA Change: F694I

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: F694I

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Kcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Kcnt2 APN 1 140523098 missense probably damaging 1.00
IGL00673:Kcnt2 APN 1 140596051 missense possibly damaging 0.60
IGL00806:Kcnt2 APN 1 140523211 missense probably damaging 1.00
IGL01135:Kcnt2 APN 1 140354555 critical splice donor site probably null 0.00
IGL01412:Kcnt2 APN 1 140570417 missense probably benign 0.02
IGL01777:Kcnt2 APN 1 140595998 missense probably benign 0.20
IGL01780:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02134:Kcnt2 APN 1 140376383 missense probably benign
IGL02350:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02357:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02481:Kcnt2 APN 1 140354561 splice site probably benign
IGL02483:Kcnt2 APN 1 140354561 splice site probably benign
IGL02866:Kcnt2 APN 1 140425248 missense probably damaging 1.00
IGL02891:Kcnt2 APN 1 140574806 missense probably damaging 1.00
IGL03007:Kcnt2 APN 1 140354507 missense possibly damaging 0.50
IGL03024:Kcnt2 APN 1 140570455 missense probably benign 0.00
IGL03231:Kcnt2 APN 1 140534002 intron probably benign
R0230:Kcnt2 UTSW 1 140246345 missense probably benign 0.00
R0367:Kcnt2 UTSW 1 140351225 missense probably damaging 1.00
R0486:Kcnt2 UTSW 1 140509480 nonsense probably null
R0543:Kcnt2 UTSW 1 140609614 missense probably damaging 1.00
R0849:Kcnt2 UTSW 1 140507762 missense probably damaging 1.00
R1123:Kcnt2 UTSW 1 140573608 missense probably damaging 1.00
R1156:Kcnt2 UTSW 1 140428855 missense probably damaging 1.00
R1425:Kcnt2 UTSW 1 140383028 missense probably damaging 1.00
R1530:Kcnt2 UTSW 1 140484232 nonsense probably null
R1546:Kcnt2 UTSW 1 140431378 missense probably benign 0.01
R1728:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1729:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1730:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1739:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1762:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1783:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1784:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1785:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1862:Kcnt2 UTSW 1 140425330 missense probably damaging 1.00
R1887:Kcnt2 UTSW 1 140584247 missense probably damaging 0.99
R1889:Kcnt2 UTSW 1 140584293 missense probably damaging 1.00
R1894:Kcnt2 UTSW 1 140425341 missense probably damaging 1.00
R2005:Kcnt2 UTSW 1 140553018 missense probably damaging 0.98
R2044:Kcnt2 UTSW 1 140375154 missense probably benign 0.14
R2115:Kcnt2 UTSW 1 140552963 missense probably damaging 1.00
R2135:Kcnt2 UTSW 1 140428813 missense probably damaging 1.00
R2201:Kcnt2 UTSW 1 140509441 missense probably damaging 1.00
R2212:Kcnt2 UTSW 1 140530800 missense probably damaging 1.00
R2267:Kcnt2 UTSW 1 140573683 splice site probably null
R2442:Kcnt2 UTSW 1 140376353 missense possibly damaging 0.59
R3121:Kcnt2 UTSW 1 140428884 missense probably damaging 0.97
R3176:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3276:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3704:Kcnt2 UTSW 1 140533968 missense probably damaging 1.00
R3944:Kcnt2 UTSW 1 140584287 missense probably damaging 1.00
R4164:Kcnt2 UTSW 1 140609630 missense probably damaging 0.97
R4201:Kcnt2 UTSW 1 140425332 missense probably damaging 0.98
R4501:Kcnt2 UTSW 1 140552980 missense probably damaging 0.99
R4502:Kcnt2 UTSW 1 140507747 missense probably damaging 0.99
R4632:Kcnt2 UTSW 1 140523148 missense possibly damaging 0.90
R4758:Kcnt2 UTSW 1 140518897 missense probably damaging 1.00
R4790:Kcnt2 UTSW 1 140354516 missense probably damaging 0.99
R4892:Kcnt2 UTSW 1 140513025 nonsense probably null
R4973:Kcnt2 UTSW 1 140609650 missense probably damaging 1.00
R5154:Kcnt2 UTSW 1 140351256 missense possibly damaging 0.94
R5296:Kcnt2 UTSW 1 140609615 missense probably damaging 1.00
R5353:Kcnt2 UTSW 1 140426901 missense probably damaging 1.00
R5605:Kcnt2 UTSW 1 140574743 missense possibly damaging 0.59
R5806:Kcnt2 UTSW 1 140509496 missense probably damaging 1.00
R5887:Kcnt2 UTSW 1 140425366 missense probably damaging 1.00
R5917:Kcnt2 UTSW 1 140533928 missense probably damaging 0.99
R5961:Kcnt2 UTSW 1 140507702 missense possibly damaging 0.82
R6123:Kcnt2 UTSW 1 140362980 missense probably damaging 1.00
R6225:Kcnt2 UTSW 1 140426923 nonsense probably null
R6248:Kcnt2 UTSW 1 140509478 missense probably damaging 1.00
R6351:Kcnt2 UTSW 1 140375112 missense probably damaging 1.00
R6380:Kcnt2 UTSW 1 140509584 missense probably damaging 1.00
R6532:Kcnt2 UTSW 1 140584106 missense probably damaging 0.97
R6693:Kcnt2 UTSW 1 140351227 missense probably benign 0.00
R6817:Kcnt2 UTSW 1 140246193 unclassified probably benign
R6856:Kcnt2 UTSW 1 140596004 missense probably damaging 1.00
R6944:Kcnt2 UTSW 1 140584065 missense probably benign 0.00
R6971:Kcnt2 UTSW 1 140512908 missense probably benign 0.01
R7052:Kcnt2 UTSW 1 140383047 missense probably damaging 0.99
R7138:Kcnt2 UTSW 1 140596040 missense possibly damaging 0.80
R7261:Kcnt2 UTSW 1 140354517 missense possibly damaging 0.71
R7474:Kcnt2 UTSW 1 140570478 missense possibly damaging 0.84
R7524:Kcnt2 UTSW 1 140584055 missense probably damaging 0.99
R7541:Kcnt2 UTSW 1 140376384 missense probably benign 0.09
R7558:Kcnt2 UTSW 1 140523190 missense probably damaging 0.98
R7651:Kcnt2 UTSW 1 140570461 missense probably benign 0.40
R7875:Kcnt2 UTSW 1 140573647 missense probably damaging 1.00
R7883:Kcnt2 UTSW 1 140523150 missense probably damaging 0.99
R7958:Kcnt2 UTSW 1 140573647 missense probably damaging 1.00
R7966:Kcnt2 UTSW 1 140523150 missense probably damaging 0.99
R8040:Kcnt2 UTSW 1 140450217 missense probably damaging 1.00
R8041:Kcnt2 UTSW 1 140609660 missense probably benign
X0062:Kcnt2 UTSW 1 140512991 missense possibly damaging 0.50
Z1088:Kcnt2 UTSW 1 140573646 missense probably damaging 1.00
Z1088:Kcnt2 UTSW 1 140584158 nonsense probably null
Z1176:Kcnt2 UTSW 1 140376361 missense probably damaging 1.00
Z1177:Kcnt2 UTSW 1 140609648 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TAACATGATAGAAGCCTAGACTCAC -3'
(R):5'- CCTAACTGACTGGTTAACATAACTGG -3'

Sequencing Primer
(F):5'- ATCTGTGCATCCTAGCTC -3'
(R):5'- GCTTTTATGTGATTTTTCAGTGAGAC -3'
Posted On2019-11-12