Incidental Mutation 'R7730:Slamf7'
ID595747
Institutional Source Beutler Lab
Gene Symbol Slamf7
Ensembl Gene ENSMUSG00000038179
Gene NameSLAM family member 7
Synonyms19A24, novel Ly9, 19A, 4930560D03Rik, CS1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171632403-171653035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 171641021 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 101 (R101H)
Ref Sequence ENSEMBL: ENSMUSP00000141259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111276] [ENSMUST00000192024] [ENSMUST00000192195] [ENSMUST00000194531] [ENSMUST00000194791]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111276
AA Change: R101H

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106907
Gene: ENSMUSG00000038179
AA Change: R101H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IG 26 122 1e-34 BLAST
PDB:2IF7|D 29 213 2e-22 PDB
Blast:IG_like 135 208 3e-13 BLAST
SCOP:d2fcba2 144 206 3e-3 SMART
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192024
AA Change: R101H

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141426
Gene: ENSMUSG00000038179
AA Change: R101H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IG 26 122 2e-35 BLAST
Pfam:Ig_3 127 196 5e-8 PFAM
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192195
AA Change: R101H

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141871
Gene: ENSMUSG00000038179
AA Change: R101H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IG 26 122 1e-34 BLAST
Pfam:Ig_3 127 196 2.3e-9 PFAM
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194531
AA Change: R101H

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141259
Gene: ENSMUSG00000038179
AA Change: R101H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IG 26 122 1e-34 BLAST
Pfam:Ig_3 127 196 6.3e-8 PFAM
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194791
AA Change: R101H

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141601
Gene: ENSMUSG00000038179
AA Change: R101H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IG 26 122 2e-35 BLAST
Pfam:Ig_3 127 196 4.6e-8 PFAM
transmembrane domain 228 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Natural Killer cells from null homozygotes display impaired cytolysis of certain target cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Slamf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Slamf7 APN 1 171639242 missense probably benign 0.00
IGL01599:Slamf7 APN 1 171641186 missense possibly damaging 0.67
IGL02441:Slamf7 APN 1 171641057 missense probably damaging 1.00
IGL02980:Slamf7 UTSW 1 171640998 missense possibly damaging 0.96
R0136:Slamf7 UTSW 1 171648931 unclassified probably benign
R0299:Slamf7 UTSW 1 171648931 unclassified probably benign
R1115:Slamf7 UTSW 1 171639183 missense probably benign 0.02
R1449:Slamf7 UTSW 1 171641038 missense possibly damaging 0.88
R4051:Slamf7 UTSW 1 171637383 missense possibly damaging 0.66
R4573:Slamf7 UTSW 1 171636366 missense probably benign 0.01
R4951:Slamf7 UTSW 1 171639125 missense probably benign 0.01
R5772:Slamf7 UTSW 1 171639270 critical splice acceptor site probably null
R5872:Slamf7 UTSW 1 171639067 missense probably damaging 0.98
R7575:Slamf7 UTSW 1 171639194 missense probably damaging 1.00
X0052:Slamf7 UTSW 1 171641214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTACACTGCACAGCCTC -3'
(R):5'- CCCTTGATGGATCTGTGACATTCAC -3'

Sequencing Primer
(F):5'- TCTCAAAGTATGCAGAGGCCTTATGG -3'
(R):5'- CGGCGTTACATCACAAAG -3'
Posted On2019-11-12