Incidental Mutation 'R7730:Brd3'
ID595750
Institutional Source Beutler Lab
Gene Symbol Brd3
Ensembl Gene ENSMUSG00000026918
Gene Namebromodomain containing 3
SynonymsRINGL3, ORFX, 2410084F24Rik, Fsrg2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location27445579-27507662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27456955 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 389 (Y389C)
Ref Sequence ENSEMBL: ENSMUSP00000076918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028282] [ENSMUST00000077737] [ENSMUST00000113941] [ENSMUST00000138693] [ENSMUST00000154316] [ENSMUST00000164296]
Predicted Effect probably damaging
Transcript: ENSMUST00000028282
AA Change: Y389C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028282
Gene: ENSMUSG00000026918
AA Change: Y389C

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
coiled coil region 455 525 N/A INTRINSIC
PDB:2JNS|A 572 645 5e-37 PDB
coiled coil region 649 684 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077737
AA Change: Y389C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076918
Gene: ENSMUSG00000026918
AA Change: Y389C

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
coiled coil region 455 525 N/A INTRINSIC
PDB:2JNS|A 572 645 5e-37 PDB
coiled coil region 649 684 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113941
AA Change: Y389C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109574
Gene: ENSMUSG00000026918
AA Change: Y389C

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
low complexity region 435 459 N/A INTRINSIC
coiled coil region 505 542 N/A INTRINSIC
Pfam:BET 589 653 1.2e-35 PFAM
coiled coil region 666 701 N/A INTRINSIC
low complexity region 708 743 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138693
AA Change: Y389C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115755
Gene: ENSMUSG00000026918
AA Change: Y389C

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
low complexity region 435 459 N/A INTRINSIC
coiled coil region 505 542 N/A INTRINSIC
PDB:2JNS|A 589 662 4e-37 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000154316
AA Change: Y389C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114422
Gene: ENSMUSG00000026918
AA Change: Y389C

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
low complexity region 435 459 N/A INTRINSIC
coiled coil region 505 542 N/A INTRINSIC
PDB:2JNS|A 589 662 4e-37 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000164296
AA Change: Y389C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128812
Gene: ENSMUSG00000026918
AA Change: Y389C

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
coiled coil region 455 525 N/A INTRINSIC
Pfam:BET 572 636 1.5e-35 PFAM
coiled coil region 649 684 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on its homology to the gene encoding the RING3 protein, a serine/threonine kinase. The gene localizes to 9q34, a region which contains several major histocompatibility complex (MHC) genes. The function of the encoded protein is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Brd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Brd3 APN 2 27464089 missense possibly damaging 0.53
IGL01685:Brd3 APN 2 27459488 missense probably damaging 1.00
IGL01911:Brd3 APN 2 27459800 missense probably damaging 1.00
IGL02105:Brd3 APN 2 27459776 missense probably damaging 1.00
IGL02649:Brd3 APN 2 27454350 missense probably damaging 1.00
IGL02715:Brd3 APN 2 27454483 missense possibly damaging 0.66
IGL02825:Brd3 APN 2 27449263 missense probably damaging 1.00
IGL02898:Brd3 APN 2 27459741 missense possibly damaging 0.81
H8562:Brd3 UTSW 2 27450533 missense possibly damaging 0.53
R1263:Brd3 UTSW 2 27462522 missense probably damaging 1.00
R1449:Brd3 UTSW 2 27450251 splice site probably null
R1449:Brd3 UTSW 2 27457016 missense probably damaging 1.00
R4351:Brd3 UTSW 2 27457016 missense probably damaging 1.00
R4840:Brd3 UTSW 2 27449239 missense possibly damaging 0.94
R5049:Brd3 UTSW 2 27450577 intron probably benign
R5131:Brd3 UTSW 2 27453415 missense probably benign
R5185:Brd3 UTSW 2 27462448 missense probably damaging 1.00
R5213:Brd3 UTSW 2 27463948 missense possibly damaging 0.81
R5261:Brd3 UTSW 2 27463919 missense probably damaging 0.99
R5326:Brd3 UTSW 2 27450544 missense probably benign
R5661:Brd3 UTSW 2 27461572 missense possibly damaging 0.68
R6439:Brd3 UTSW 2 27463926 missense probably damaging 1.00
R6952:Brd3 UTSW 2 27454359 missense probably damaging 1.00
R7039:Brd3 UTSW 2 27456917 missense probably damaging 0.96
R7103:Brd3 UTSW 2 27450394 missense probably damaging 0.97
R7168:Brd3 UTSW 2 27454399 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCAGGATCTCACACAGGTAG -3'
(R):5'- AATTGCCAGATGCCTGACTG -3'

Sequencing Primer
(F):5'- TGGAAGCAAGGCGCCTCAG -3'
(R):5'- CCTGACTGGCAGTTGGC -3'
Posted On2019-11-12