Incidental Mutation 'R7730:Cercam'
ID595751
Institutional Source Beutler Lab
Gene Symbol Cercam
Ensembl Gene ENSMUSG00000039787
Gene Namecerebral endothelial cell adhesion molecule
SynonymsCeecam1, CerCAM
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location29869164-29882840 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to A at 29872562 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047521] [ENSMUST00000134152] [ENSMUST00000154464]
Predicted Effect probably null
Transcript: ENSMUST00000047521
SMART Domains Protein: ENSMUSP00000041622
Gene: ENSMUSG00000039787

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 37 157 2.6e-15 PFAM
Pfam:Glyco_transf_25 316 500 3.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134152
SMART Domains Protein: ENSMUSP00000115902
Gene: ENSMUSG00000039787

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154464
SMART Domains Protein: ENSMUSP00000119476
Gene: ENSMUSG00000039787

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Cercam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01885:Cercam APN 2 29881003 missense probably damaging 1.00
IGL02619:Cercam APN 2 29880674 missense probably benign 0.05
IGL03088:Cercam APN 2 29881687 splice site probably benign
I1329:Cercam UTSW 2 29871085 missense probably damaging 1.00
P0042:Cercam UTSW 2 29881083 missense probably damaging 1.00
R0086:Cercam UTSW 2 29871064 missense probably damaging 1.00
R0829:Cercam UTSW 2 29871067 missense probably damaging 0.98
R1442:Cercam UTSW 2 29880640 missense probably benign
R1558:Cercam UTSW 2 29876239 missense probably benign 0.35
R1997:Cercam UTSW 2 29872923 missense probably benign 0.11
R4678:Cercam UTSW 2 29869677 missense probably damaging 1.00
R4889:Cercam UTSW 2 29881833 missense probably damaging 0.96
R4891:Cercam UTSW 2 29869271 unclassified probably benign
R4967:Cercam UTSW 2 29871021 critical splice acceptor site probably null
R5052:Cercam UTSW 2 29875627 missense probably damaging 1.00
R5541:Cercam UTSW 2 29875629 missense probably benign
R5650:Cercam UTSW 2 29881815 missense probably damaging 1.00
R7072:Cercam UTSW 2 29881924 missense probably benign 0.00
R7422:Cercam UTSW 2 29872880 missense possibly damaging 0.81
R7585:Cercam UTSW 2 29881731 missense probably damaging 1.00
R7725:Cercam UTSW 2 29872562 critical splice acceptor site probably null
R7747:Cercam UTSW 2 29871286 missense probably benign 0.02
R8504:Cercam UTSW 2 29881817 missense possibly damaging 0.86
RF016:Cercam UTSW 2 29869305 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCAGAAATGGTTAGCCCC -3'
(R):5'- GCCTTGAAGCCTCAGGATCTATC -3'

Sequencing Primer
(F):5'- TAAGTGCACATGCCATGGTATG -3'
(R):5'- GGATCTATCCTCCCCCTGGG -3'
Posted On2019-11-12