Incidental Mutation 'R7730:Fer1l4'
ID595754
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Namefer-1-like 4 (C. elegans)
Synonyms9130402C12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location156019139-156052947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 156048934 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 188 (P188Q)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611]
Predicted Effect probably benign
Transcript: ENSMUST00000109611
AA Change: P188Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: P188Q

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 156019920 nonsense probably null
IGL01025:Fer1l4 APN 2 156052185 missense probably benign 0.41
IGL01103:Fer1l4 APN 2 156044441 critical splice donor site probably null
IGL01322:Fer1l4 APN 2 156020339 splice site probably null
IGL01391:Fer1l4 APN 2 156036456 missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 156048451 missense probably benign
IGL02267:Fer1l4 APN 2 156031252 missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 156019538 missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 156045428 missense probably benign 0.04
IGL02423:Fer1l4 APN 2 156052907 missense probably benign 0.04
IGL02596:Fer1l4 APN 2 156039132 missense probably benign
IGL02612:Fer1l4 APN 2 156047928 missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 156029715 missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 156045728 missense probably benign
IGL03035:Fer1l4 APN 2 156022606 missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 156039366 unclassified probably benign
IGL03201:Fer1l4 APN 2 156044730 missense probably benign 0.32
IGL03349:Fer1l4 APN 2 156044734 nonsense probably null
R0033:Fer1l4 UTSW 2 156024106 splice site probably benign
R0356:Fer1l4 UTSW 2 156024010 missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 156052886 missense probably benign 0.43
R0504:Fer1l4 UTSW 2 156052195 missense probably benign 0.36
R0731:Fer1l4 UTSW 2 156024070 missense probably benign 0.17
R0800:Fer1l4 UTSW 2 156045663 missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 156019313 missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 156049478 critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 156046249 missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 156045633 missense probably benign 0.00
R1657:Fer1l4 UTSW 2 156035598 missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 156029685 missense probably benign 0.14
R1816:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 156048274 missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 156039118 missense probably benign 0.00
R2219:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 156052200 missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 156035048 missense probably benign 0.01
R3806:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 156020389 missense probably benign 0.37
R4274:Fer1l4 UTSW 2 156020544 missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 156036639 missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 156047087 missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 156045623 missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4915:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4917:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4918:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4941:Fer1l4 UTSW 2 156045089 missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 156049466 missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 156037366 nonsense probably null
R5441:Fer1l4 UTSW 2 156023257 missense probably benign 0.00
R5555:Fer1l4 UTSW 2 156048189 missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 156051993 missense probably benign 0.01
R6125:Fer1l4 UTSW 2 156046987 missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 156048291 missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 156024982 missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 156046171 missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 156029268 missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 156024740 missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 156048250 missense probably benign 0.08
R6490:Fer1l4 UTSW 2 156047914 missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 156045470 missense probably benign 0.02
R6516:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 156047865 critical splice donor site probably null
R6740:Fer1l4 UTSW 2 156031222 missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 156036730 missense probably benign 0.05
R7121:Fer1l4 UTSW 2 156044557 missense probably benign 0.13
R7132:Fer1l4 UTSW 2 156045626 missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 156020749 nonsense probably null
R7631:Fer1l4 UTSW 2 156048275 missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 156020431 missense possibly damaging 0.51
R8021:Fer1l4 UTSW 2 156022591 missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 156045529 small deletion probably benign
X0063:Fer1l4 UTSW 2 156035011 missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 156048429 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGATGCCAGTGTATCCACCC -3'
(R):5'- GAGTTAGTCCCAGGGTAAGC -3'

Sequencing Primer
(F):5'- AGTGTATCCACCCTTCCGG -3'
(R):5'- CAATCTGAAGGTTAAAGGTCAGTTC -3'
Posted On2019-11-12