Incidental Mutation 'R7730:Mtf1'
ID595757
Institutional Source Beutler Lab
Gene Symbol Mtf1
Ensembl Gene ENSMUSG00000028890
Gene Namemetal response element binding transcription factor 1
SynonymsThyls, metalloregulatory transcription factor, MTF-1, metal response element-binding transcription factor 1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location124802104-124849800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 124838619 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 490 (A490E)
Ref Sequence ENSEMBL: ENSMUSP00000030723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030723] [ENSMUST00000106193]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030723
AA Change: A490E

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030723
Gene: ENSMUSG00000028890
AA Change: A490E

DomainStartEndE-ValueType
ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106193
AA Change: A490E

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101799
Gene: ENSMUSG00000028890
AA Change: A490E

DomainStartEndE-ValueType
ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that induces expression of metallothioneins and other genes involved in metal homeostasis in response to heavy metals such as cadmium, zinc, copper, and silver. The protein is a nucleocytoplasmic shuttling protein that accumulates in the nucleus upon heavy metal exposure and binds to promoters containing a metal-responsive element (MRE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation show impaired hepatocyte development followed by embryonic liver degeneration, generalized edema, and death at ~14 days of gestation. Mutant embryonic fibroblasts show increased susceptibility to the cytotoxiceffects of cadmium and hydrogen peroxide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Mtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01902:Mtf1 APN 4 124804927 missense probably damaging 0.99
IGL02491:Mtf1 APN 4 124838579 missense probably benign 0.00
IGL02493:Mtf1 APN 4 124821319 missense probably damaging 1.00
IGL02644:Mtf1 APN 4 124820235 missense probably damaging 1.00
IGL02661:Mtf1 APN 4 124825109 missense probably damaging 0.98
IGL03018:Mtf1 APN 4 124838663 missense probably benign 0.44
LCD18:Mtf1 UTSW 4 124829316 intron probably benign
R0443:Mtf1 UTSW 4 124824282 unclassified probably benign
R0599:Mtf1 UTSW 4 124820201 splice site probably benign
R1103:Mtf1 UTSW 4 124838468 missense probably benign 0.28
R2496:Mtf1 UTSW 4 124838904 missense probably benign 0.01
R4258:Mtf1 UTSW 4 124838783 missense probably benign 0.00
R4818:Mtf1 UTSW 4 124804712 start codon destroyed probably null 1.00
R5085:Mtf1 UTSW 4 124821308 missense probably damaging 1.00
R5248:Mtf1 UTSW 4 124820427 missense probably damaging 1.00
R5368:Mtf1 UTSW 4 124825079 missense probably damaging 0.98
R6368:Mtf1 UTSW 4 124824352 missense probably damaging 1.00
R6768:Mtf1 UTSW 4 124837785 missense probably benign 0.01
R7417:Mtf1 UTSW 4 124825181 missense probably null 0.00
R7559:Mtf1 UTSW 4 124820206 missense probably damaging 1.00
R7739:Mtf1 UTSW 4 124824288 missense probably damaging 1.00
X0018:Mtf1 UTSW 4 124838847 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GTCCGTCATTGATGTCCCAC -3'
(R):5'- AGTTAGGACAGAGTTGGCAC -3'

Sequencing Primer
(F):5'- CAGGAAATTCGGCGTCTTTATC -3'
(R):5'- ACAGAGTTGGCACCCAGG -3'
Posted On2019-11-12