Incidental Mutation 'R7730:Zfp384'
ID595763
Institutional Source Beutler Lab
Gene Symbol Zfp384
Ensembl Gene ENSMUSG00000038346
Gene Namezinc finger protein 384
SynonymsC130073D16Rik, Nmp4, Ciz
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location125009145-125037870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125031672 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 306 (I306V)
Ref Sequence ENSEMBL: ENSMUSP00000081296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046064] [ENSMUST00000054553] [ENSMUST00000084275] [ENSMUST00000088308] [ENSMUST00000112424] [ENSMUST00000112425] [ENSMUST00000112427] [ENSMUST00000112428]
Predicted Effect probably benign
Transcript: ENSMUST00000046064
SMART Domains Protein: ENSMUSP00000037986
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054553
SMART Domains Protein: ENSMUSP00000086354
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
ZnF_C2H2 174 196 7.26e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 230 252 1.95e-3 SMART
ZnF_C2H2 258 282 7.37e-4 SMART
ZnF_C2H2 288 310 5.06e-2 SMART
ZnF_C2H2 318 340 3.44e-4 SMART
low complexity region 346 404 N/A INTRINSIC
low complexity region 405 410 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084275
AA Change: I306V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000081296
Gene: ENSMUSG00000038346
AA Change: I306V

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088308
AA Change: I306V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000085648
Gene: ENSMUSG00000038346
AA Change: I306V

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112424
AA Change: I290V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108043
Gene: ENSMUSG00000038346
AA Change: I290V

DomainStartEndE-ValueType
low complexity region 172 183 N/A INTRINSIC
ZnF_C2H2 213 235 7.26e-3 SMART
ZnF_C2H2 241 263 2.99e-4 SMART
ZnF_C2H2 269 291 1.95e-3 SMART
ZnF_C2H2 302 324 7.37e-4 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 382 7.37e-4 SMART
ZnF_C2H2 388 410 5.06e-2 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
low complexity region 446 504 N/A INTRINSIC
low complexity region 505 510 N/A INTRINSIC
low complexity region 513 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112425
SMART Domains Protein: ENSMUSP00000108044
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 313 337 7.37e-4 SMART
ZnF_C2H2 343 365 5.06e-2 SMART
ZnF_C2H2 373 395 3.44e-4 SMART
low complexity region 401 459 N/A INTRINSIC
low complexity region 460 465 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112427
AA Change: I306V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108046
Gene: ENSMUSG00000038346
AA Change: I306V

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112428
SMART Domains Protein: ENSMUSP00000108047
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein, which may function as a transcription factor. This gene also contains long CAG trinucleotide repeats that encode consecutive glutamine residues. The protein appears to bind and regulate the promoters of the extracellular matrix genes MMP1, MMP3, MMP7 and COL1A1. Studies in mouse suggest that nuclear matrix transcription factors (NP/NMP4) may be part of a general mechanical pathway that couples cell construction and function during extracellular matrix remodeling. Alternative splicing results in multiple transcript variants. Recurrent rearrangements of this gene with the Ewing's sarcoma gene, EWSR1 on chromosome 22, or with the TAF15 gene on chromosome 17, or with the TCF3 (E2A) gene on chromosome 19, have been observed in acute leukemia. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mice are small and males have a small testis. Some males develop infertility and exhibit variable degrees of spermatogenic cell degeneration within the seminiferous tubules and increased apoptosis of spermatogenic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Zfp384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Zfp384 APN 6 125025053 missense probably benign 0.03
IGL01568:Zfp384 APN 6 125024132 missense probably damaging 1.00
IGL01632:Zfp384 APN 6 125024761 missense probably damaging 1.00
IGL03408:Zfp384 APN 6 125035713 missense probably damaging 1.00
FR4304:Zfp384 UTSW 6 125036493 unclassified probably benign
FR4340:Zfp384 UTSW 6 125036463 unclassified probably benign
R0839:Zfp384 UTSW 6 125036668 missense probably benign 0.01
R1370:Zfp384 UTSW 6 125036453 missense probably benign 0.04
R1427:Zfp384 UTSW 6 125024884 missense probably damaging 1.00
R2441:Zfp384 UTSW 6 125036649 missense probably benign 0.01
R2986:Zfp384 UTSW 6 125024896 missense possibly damaging 0.78
R4003:Zfp384 UTSW 6 125033237 splice site probably benign
R4833:Zfp384 UTSW 6 125030848 missense probably damaging 1.00
R4860:Zfp384 UTSW 6 125030930 synonymous silent
R5084:Zfp384 UTSW 6 125023679 splice site probably benign
R5137:Zfp384 UTSW 6 125036509 unclassified probably benign
R5449:Zfp384 UTSW 6 125024138 missense probably damaging 1.00
R5558:Zfp384 UTSW 6 125036509 unclassified probably benign
R5720:Zfp384 UTSW 6 125036624 missense probably benign 0.19
R5849:Zfp384 UTSW 6 125024099 missense possibly damaging 0.91
R5961:Zfp384 UTSW 6 125024034 missense probably damaging 1.00
R6165:Zfp384 UTSW 6 125024933 unclassified probably null
R6948:Zfp384 UTSW 6 125024910 missense probably benign 0.08
R7106:Zfp384 UTSW 6 125024259 missense probably benign 0.23
R7192:Zfp384 UTSW 6 125033312 missense probably damaging 1.00
R7320:Zfp384 UTSW 6 125024830 missense possibly damaging 0.92
R7861:Zfp384 UTSW 6 125036325 missense probably damaging 1.00
R7944:Zfp384 UTSW 6 125036325 missense probably damaging 1.00
RF002:Zfp384 UTSW 6 125036471 unclassified probably benign
RF003:Zfp384 UTSW 6 125036471 unclassified probably benign
RF003:Zfp384 UTSW 6 125036476 unclassified probably benign
RF003:Zfp384 UTSW 6 125036483 unclassified probably benign
RF010:Zfp384 UTSW 6 125036471 unclassified probably benign
RF010:Zfp384 UTSW 6 125036488 unclassified probably benign
RF011:Zfp384 UTSW 6 125036476 unclassified probably benign
RF014:Zfp384 UTSW 6 125036466 unclassified probably benign
RF015:Zfp384 UTSW 6 125036481 unclassified probably benign
RF018:Zfp384 UTSW 6 125036489 unclassified probably benign
RF020:Zfp384 UTSW 6 125036455 unclassified probably benign
RF020:Zfp384 UTSW 6 125036488 unclassified probably benign
RF022:Zfp384 UTSW 6 125036471 unclassified probably benign
RF024:Zfp384 UTSW 6 125036489 unclassified probably benign
RF026:Zfp384 UTSW 6 125036492 unclassified probably benign
RF027:Zfp384 UTSW 6 125036490 unclassified probably benign
RF030:Zfp384 UTSW 6 125036483 unclassified probably benign
RF056:Zfp384 UTSW 6 125036490 unclassified probably benign
RF057:Zfp384 UTSW 6 125036496 unclassified probably benign
RF062:Zfp384 UTSW 6 125036466 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGCAACCTAGACATGGG -3'
(R):5'- AGTTATAGCCTCCTCCAGCCAG -3'

Sequencing Primer
(F):5'- ACATGGGTGTCCTCTTCATTAG -3'
(R):5'- TCCAGCCAGGTCTCACC -3'
Posted On2019-11-12