Incidental Mutation 'R7730:Tbc1d9b'
ID595773
Institutional Source Beutler Lab
Gene Symbol Tbc1d9b
Ensembl Gene ENSMUSG00000036644
Gene NameTBC1 domain family, member 9B
Synonyms2700008N14Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location50131396-50172785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50135915 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 70 (V70A)
Ref Sequence ENSEMBL: ENSMUSP00000090825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093138] [ENSMUST00000101270]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093138
AA Change: V70A

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090825
Gene: ENSMUSG00000036644
AA Change: V70A

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
GRAM 142 209 1.21e-26 SMART
GRAM 288 356 3.02e-22 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 422 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
TBC 506 719 1.18e-57 SMART
Blast:TBC 727 810 2e-28 BLAST
low complexity region 1124 1138 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101270
AA Change: V70A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098828
Gene: ENSMUSG00000036644
AA Change: V70A

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
GRAM 142 209 1.21e-26 SMART
GRAM 288 356 3.02e-22 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 422 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
TBC 506 719 1.18e-57 SMART
Blast:TBC 727 810 3e-28 BLAST
low complexity region 970 980 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
low complexity region 1161 1172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Tbc1d9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Tbc1d9b APN 11 50161633 missense probably damaging 1.00
IGL01870:Tbc1d9b APN 11 50162088 missense probably damaging 1.00
IGL02082:Tbc1d9b APN 11 50163882 missense probably benign 0.00
IGL02105:Tbc1d9b APN 11 50149826 missense probably damaging 0.96
IGL02264:Tbc1d9b APN 11 50149757 missense probably damaging 0.98
IGL02801:Tbc1d9b APN 11 50152830 missense probably damaging 1.00
IGL03111:Tbc1d9b APN 11 50158542 missense probably damaging 1.00
IGL02988:Tbc1d9b UTSW 11 50151946 missense possibly damaging 0.80
R0102:Tbc1d9b UTSW 11 50135849 missense probably damaging 1.00
R0109:Tbc1d9b UTSW 11 50158434 missense probably benign 0.02
R0131:Tbc1d9b UTSW 11 50135924 missense probably benign
R0463:Tbc1d9b UTSW 11 50145067 missense probably benign 0.00
R0472:Tbc1d9b UTSW 11 50168228 splice site probably null
R0846:Tbc1d9b UTSW 11 50171321 missense probably benign 0.01
R1099:Tbc1d9b UTSW 11 50146308 missense probably benign 0.04
R1276:Tbc1d9b UTSW 11 50152649 missense possibly damaging 0.87
R1642:Tbc1d9b UTSW 11 50149832 missense probably damaging 0.98
R2679:Tbc1d9b UTSW 11 50161701 splice site probably null
R2915:Tbc1d9b UTSW 11 50149736 missense possibly damaging 0.95
R3825:Tbc1d9b UTSW 11 50171127 missense possibly damaging 0.85
R3964:Tbc1d9b UTSW 11 50168696 missense possibly damaging 0.50
R4051:Tbc1d9b UTSW 11 50171243 missense probably benign 0.09
R4705:Tbc1d9b UTSW 11 50140462 missense probably benign 0.33
R4783:Tbc1d9b UTSW 11 50171298 missense probably benign 0.00
R5330:Tbc1d9b UTSW 11 50146313 missense probably benign
R5331:Tbc1d9b UTSW 11 50146313 missense probably benign
R5888:Tbc1d9b UTSW 11 50140484 missense probably benign 0.15
R5949:Tbc1d9b UTSW 11 50148049 missense probably benign
R6144:Tbc1d9b UTSW 11 50146328 missense probably benign
R6166:Tbc1d9b UTSW 11 50135846 missense probably damaging 1.00
R6331:Tbc1d9b UTSW 11 50131497 missense possibly damaging 0.95
R6432:Tbc1d9b UTSW 11 50146328 missense probably benign
R6856:Tbc1d9b UTSW 11 50168746 missense probably benign 0.11
R7110:Tbc1d9b UTSW 11 50163830 missense probably benign 0.09
R7134:Tbc1d9b UTSW 11 50152692 missense possibly damaging 0.55
R7372:Tbc1d9b UTSW 11 50168688 splice site probably null
R7464:Tbc1d9b UTSW 11 50131485 missense probably damaging 1.00
R7508:Tbc1d9b UTSW 11 50145120 missense probably damaging 0.97
R7584:Tbc1d9b UTSW 11 50170716 missense probably damaging 1.00
R7747:Tbc1d9b UTSW 11 50161620 missense probably benign 0.39
R7963:Tbc1d9b UTSW 11 50168109 intron probably null
X0065:Tbc1d9b UTSW 11 50168183 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCTGTGAGTAGTTGGAAGTC -3'
(R):5'- TGAGGTCCAACCACATCTCC -3'

Sequencing Primer
(F):5'- AAGTCTGGCAGTGCTGTGC -3'
(R):5'- GGTCCAACCACATCTCCCTTGAG -3'
Posted On2019-11-12