Incidental Mutation 'R7730:Dld'
ID595775
Institutional Source Beutler Lab
Gene Symbol Dld
Ensembl Gene ENSMUSG00000020664
Gene Namedihydrolipoamide dehydrogenase
Synonymsbranched chain alpha-keto acid dehydrogenase complex subunit E3, dihydrolipoyl dehydrogenase
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location31331277-31351453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31340865 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 194 (T194K)
Ref Sequence ENSEMBL: ENSMUSP00000106481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110857]
Predicted Effect probably benign
Transcript: ENSMUST00000110857
AA Change: T194K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106481
Gene: ENSMUSG00000020664
AA Change: T194K

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 42 370 2.3e-71 PFAM
Pfam:FAD_binding_2 43 83 2.5e-7 PFAM
Pfam:GIDA 43 111 1.7e-8 PFAM
Pfam:FAD_oxidored 43 135 4.3e-10 PFAM
Pfam:NAD_binding_8 46 100 1.4e-6 PFAM
Pfam:Pyr_redox 215 298 4.9e-17 PFAM
Pfam:Pyr_redox_dim 389 498 1.6e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In homodimeric form, the encoded protein functions as a dehydrogenase and is found in several multi-enzyme complexes that regulate energy metabolism. However, as a monomer, this protein can function as a protease. [provided by RefSeq, Jan 2014]
PHENOTYPE: Embryos homozygous for a targeted null mutation exhibit a developmental delay at 7.5 days postcoitum and are resorbed by 9.5 days postcoitum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Dld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Dld APN 12 31335577 missense probably benign
IGL00656:Dld APN 12 31349595 critical splice donor site probably null
IGL00907:Dld APN 12 31332330 unclassified probably benign
IGL01870:Dld APN 12 31335467 missense possibly damaging 0.89
IGL02654:Dld APN 12 31333917 missense probably benign 0.19
IGL02666:Dld APN 12 31332409 missense probably null 0.00
PIT4544001:Dld UTSW 12 31335557 nonsense probably null
R0973:Dld UTSW 12 31334054 missense probably damaging 1.00
R1748:Dld UTSW 12 31334746 missense probably benign
R2225:Dld UTSW 12 31341449 missense probably benign 0.01
R4614:Dld UTSW 12 31333945 nonsense probably null
R5933:Dld UTSW 12 31333983 missense probably benign 0.00
R5966:Dld UTSW 12 31340326 missense probably damaging 1.00
R6088:Dld UTSW 12 31340989 missense probably benign
R6190:Dld UTSW 12 31344848 missense probably damaging 1.00
R6327:Dld UTSW 12 31332191 missense probably benign
R6750:Dld UTSW 12 31332214 missense probably benign 0.00
R7149:Dld UTSW 12 31335590 missense probably benign
R7414:Dld UTSW 12 31335526 missense probably damaging 1.00
X0065:Dld UTSW 12 31341389 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATAAAGCTCCTGTAGATGACAC -3'
(R):5'- AGAGTATTGTTCCTGTTACTCCTG -3'

Sequencing Primer
(F):5'- CAGAGACAGTCTTGCTATGTAGTCC -3'
(R):5'- CTCAGGAAAACATTGAAACATTGTG -3'
Posted On2019-11-12