Incidental Mutation 'R7730:Mcpt4'
ID595784
Institutional Source Beutler Lab
Gene Symbol Mcpt4
Ensembl Gene ENSMUSG00000061068
Gene Namemast cell protease 4
SynonymsMMCP-4B, Mcp4, myonase, Mcp-4, MMCP-4, MMCP-4A
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location56059629-56062313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56059971 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 243 (I243L)
Ref Sequence ENSEMBL: ENSMUSP00000038103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043249]
Predicted Effect probably benign
Transcript: ENSMUST00000043249
AA Change: I243L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038103
Gene: ENSMUSG00000061068
AA Change: I243L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 20 239 6.1e-88 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this locus affects thrombin regulation and fibronectin turnover. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Mcpt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Mcpt4 APN 14 56061030 missense probably benign
IGL02733:Mcpt4 APN 14 56060667 missense probably benign 0.03
R0622:Mcpt4 UTSW 14 56060662 missense probably benign 0.06
R1699:Mcpt4 UTSW 14 56059959 makesense probably null
R4298:Mcpt4 UTSW 14 56060987 missense possibly damaging 0.70
R4413:Mcpt4 UTSW 14 56060536 missense probably damaging 0.98
R5191:Mcpt4 UTSW 14 56061009 missense probably benign 0.00
R5378:Mcpt4 UTSW 14 56062293 utr 5 prime probably null
R6650:Mcpt4 UTSW 14 56060633 missense possibly damaging 0.82
R7062:Mcpt4 UTSW 14 56060668 missense probably benign 0.09
R7809:Mcpt4 UTSW 14 56060684 missense possibly damaging 0.77
X0019:Mcpt4 UTSW 14 56062272 start codon destroyed probably null 0.94
Z1088:Mcpt4 UTSW 14 56060510 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTGCATTACAGGGAACAGTC -3'
(R):5'- CCCATGGAGTTAGCTATGATGGG -3'

Sequencing Primer
(F):5'- CCATCATCACAGAATTCATCTTTCAG -3'
(R):5'- GTAGTTGGGGGAATGTGATCTATGC -3'
Posted On2019-11-12