Incidental Mutation 'R7730:Zmym2'
ID595785
Institutional Source Beutler Lab
Gene Symbol Zmym2
Ensembl Gene ENSMUSG00000021945
Gene Namezinc finger, MYM-type 2
SynonymsRAMP, FIM, MYM, Zfp198, SCLL
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.674) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location56886653-56962701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56956181 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1151 (Y1151F)
Ref Sequence ENSEMBL: ENSMUSP00000022511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022511]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022511
AA Change: Y1151F

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022511
Gene: ENSMUSG00000021945
AA Change: Y1151F

DomainStartEndE-ValueType
TRASH 330 366 1.55e-5 SMART
TRASH 372 412 7.69e-1 SMART
TRASH 424 459 7.5e1 SMART
TRASH 466 505 6.53e-4 SMART
Pfam:zf-FCS 527 569 1.8e-9 PFAM
TRASH 583 619 4.79e1 SMART
TRASH 638 674 8.49e-3 SMART
TRASH 680 715 7.28e-2 SMART
TRASH 726 761 1.95e-2 SMART
TRASH 767 802 3.89e1 SMART
low complexity region 881 895 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 1087 1111 N/A INTRINSIC
Pfam:DUF3504 1191 1359 7.3e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that contains nine MYM-type zinc finger motifs. Expression of this gene may mediate the inhibition of hematopoietic cell development during ontogeny, and the encoded protein may also play a role in transforming growth factor-beta signaling as a Smad binding protein. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Other mutations in Zmym2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Zmym2 APN 14 56947937 splice site probably benign
IGL00587:Zmym2 APN 14 56903360 missense possibly damaging 0.86
IGL00736:Zmym2 APN 14 56903211 missense probably benign 0.01
IGL00753:Zmym2 APN 14 56957060 nonsense probably null
IGL01608:Zmym2 APN 14 56948015 missense possibly damaging 0.57
IGL01744:Zmym2 APN 14 56946572 missense probably benign 0.24
IGL02150:Zmym2 APN 14 56911069 splice site probably benign
IGL02186:Zmym2 APN 14 56943351 missense probably benign 0.09
IGL02654:Zmym2 APN 14 56911315 missense probably damaging 1.00
IGL02960:Zmym2 APN 14 56938413 missense probably benign 0.09
IGL03104:Zmym2 APN 14 56950327 missense possibly damaging 0.88
IGL03162:Zmym2 APN 14 56914043 missense probably benign 0.24
IGL03356:Zmym2 APN 14 56957060 nonsense probably null
IGL03412:Zmym2 APN 14 56959719 nonsense probably null
R0131:Zmym2 UTSW 14 56943258 missense probably benign
R0131:Zmym2 UTSW 14 56943258 missense probably benign
R0132:Zmym2 UTSW 14 56943258 missense probably benign
R0270:Zmym2 UTSW 14 56949684 splice site probably null
R0834:Zmym2 UTSW 14 56956963 missense probably damaging 1.00
R1071:Zmym2 UTSW 14 56959821 missense possibly damaging 0.93
R1386:Zmym2 UTSW 14 56913091 missense probably damaging 1.00
R1442:Zmym2 UTSW 14 56943327 missense probably damaging 0.99
R1472:Zmym2 UTSW 14 56911183 missense probably benign 0.20
R1595:Zmym2 UTSW 14 56920730 missense probably benign 0.25
R1598:Zmym2 UTSW 14 56902769 missense possibly damaging 0.94
R1598:Zmym2 UTSW 14 56914067 missense probably damaging 1.00
R1916:Zmym2 UTSW 14 56959842 missense probably damaging 1.00
R2261:Zmym2 UTSW 14 56928262 missense probably damaging 1.00
R2393:Zmym2 UTSW 14 56920723 missense probably benign 0.17
R2866:Zmym2 UTSW 14 56928248 missense probably damaging 1.00
R3727:Zmym2 UTSW 14 56919349 splice site probably benign
R3847:Zmym2 UTSW 14 56921499 splice site probably benign
R4043:Zmym2 UTSW 14 56958308 splice site probably benign
R4074:Zmym2 UTSW 14 56903004 missense probably damaging 0.99
R4343:Zmym2 UTSW 14 56921562 missense probably damaging 0.99
R4420:Zmym2 UTSW 14 56956878 missense probably damaging 0.98
R4645:Zmym2 UTSW 14 56928307 missense probably damaging 1.00
R5015:Zmym2 UTSW 14 56921594 missense probably damaging 1.00
R5038:Zmym2 UTSW 14 56956180 missense possibly damaging 0.86
R5223:Zmym2 UTSW 14 56946514 missense probably benign
R5364:Zmym2 UTSW 14 56920645 missense possibly damaging 0.58
R5488:Zmym2 UTSW 14 56956255 missense possibly damaging 0.56
R5489:Zmym2 UTSW 14 56956255 missense possibly damaging 0.56
R5818:Zmym2 UTSW 14 56946529 missense probably benign
R6160:Zmym2 UTSW 14 56950309 missense probably damaging 1.00
R6437:Zmym2 UTSW 14 56903004 missense probably damaging 1.00
R7107:Zmym2 UTSW 14 56902712 missense probably benign 0.01
R7153:Zmym2 UTSW 14 56950202 missense probably benign 0.16
R7337:Zmym2 UTSW 14 56944100 missense probably benign 0.04
R7535:Zmym2 UTSW 14 56957079 missense probably damaging 1.00
R7779:Zmym2 UTSW 14 56928283 missense probably damaging 1.00
R7849:Zmym2 UTSW 14 56946563 missense probably benign 0.03
R8219:Zmym2 UTSW 14 56925859 missense probably benign 0.07
R8493:Zmym2 UTSW 14 56914149 missense probably damaging 1.00
Z1176:Zmym2 UTSW 14 56912999 missense possibly damaging 0.94
Z1177:Zmym2 UTSW 14 56913962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGTTCCAAACTGATGTTTC -3'
(R):5'- GAGCTCACGTTCACAAGCTC -3'

Sequencing Primer
(F):5'- CCAAACTGATGTTTCTTACCCAG -3'
(R):5'- GTTCACAAGCTCTTCCATCGTAAC -3'
Posted On2019-11-12