Incidental Mutation 'R7730:Tnfrsf11b'
ID595789
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11b
Ensembl Gene ENSMUSG00000063727
Gene Nametumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)
SynonymsOpg, OCIF, OPG, TR1, osteoclastogenesis inhibitory factor
Accession Numbers

NCBI RefSeq: NM_008764.3; MGI:109587

Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location54250619-54278484 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 54254074 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 262 (R262*)
Ref Sequence ENSEMBL: ENSMUSP00000078705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079772]
PDB Structure
Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000079772
AA Change: R262*
SMART Domains Protein: ENSMUSP00000078705
Gene: ENSMUSG00000063727
AA Change: R262*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 24 62 1.04e-2 SMART
TNFR 65 105 1.5e-8 SMART
TNFR 107 142 2.19e-10 SMART
TNFR 145 185 7.63e-1 SMART
DEATH 270 365 1.01e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 2181227
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have abnormal bone remodeling that results in severe osteoperosis with increased risk of fractures and growth retardation. Progressive hearing loss also results due to abnormal remodeling of the otic capsule. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Tnfrsf11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnfrsf11b APN 15 54259842 missense probably damaging 1.00
IGL00770:Tnfrsf11b APN 15 54254072 missense probably benign 0.16
IGL00774:Tnfrsf11b APN 15 54254072 missense probably benign 0.16
IGL02355:Tnfrsf11b APN 15 54252382 missense probably damaging 0.96
IGL02362:Tnfrsf11b APN 15 54252382 missense probably damaging 0.96
IGL02711:Tnfrsf11b APN 15 54256136 missense probably benign 0.01
IGL02870:Tnfrsf11b APN 15 54256027 missense probably benign 0.05
IGL03219:Tnfrsf11b APN 15 54254178 nonsense probably null
P0012:Tnfrsf11b UTSW 15 54259798 splice site probably benign
R1550:Tnfrsf11b UTSW 15 54254058 missense possibly damaging 0.94
R1813:Tnfrsf11b UTSW 15 54256097 nonsense probably null
R3840:Tnfrsf11b UTSW 15 54252082 missense probably damaging 0.99
R3910:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R3911:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R3912:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R4299:Tnfrsf11b UTSW 15 54252095 missense probably benign
R4362:Tnfrsf11b UTSW 15 54256159 missense possibly damaging 0.94
R4363:Tnfrsf11b UTSW 15 54256159 missense possibly damaging 0.94
R5288:Tnfrsf11b UTSW 15 54278226 missense probably benign 0.00
R5653:Tnfrsf11b UTSW 15 54259866 missense probably damaging 1.00
R5753:Tnfrsf11b UTSW 15 54254059 missense possibly damaging 0.90
R6881:Tnfrsf11b UTSW 15 54254143 missense probably benign 0.00
R6997:Tnfrsf11b UTSW 15 54252374 missense probably damaging 0.99
R7704:Tnfrsf11b UTSW 15 54260101 missense probably benign 0.30
R8052:Tnfrsf11b UTSW 15 54252106 missense probably damaging 1.00
R8060:Tnfrsf11b UTSW 15 54254109 missense probably benign 0.38
X0025:Tnfrsf11b UTSW 15 54278235 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GAACAGAACCATTCTTAGCTGTAAC -3'
(R):5'- GAGGCCTTCTTCAGGTTTGC -3'

Sequencing Primer
(F):5'- GCTGTAACAGGAATTGTGTCTACAC -3'
(R):5'- AGGTTTGCTGTTCCTACCAAG -3'
Posted On2019-11-12