Incidental Mutation 'R0242:Slc46a1'
ID 59579
Institutional Source Beutler Lab
Gene Symbol Slc46a1
Ensembl Gene ENSMUSG00000020829
Gene Name solute carrier family 46, member 1
Synonyms HCP1, heme carrier protein 1, D11Ertd18e, 1110002C08Rik, PCFT
MMRRC Submission 038480-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0242 (G1)
Quality Score 212
Status Validated
Chromosome 11
Chromosomal Location 78356527-78362771 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78359493 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 375 (I375T)
Ref Sequence ENSEMBL: ENSMUSP00000001126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001126] [ENSMUST00000061174] [ENSMUST00000108287] [ENSMUST00000146431]
AlphaFold Q6PEM8
Predicted Effect possibly damaging
Transcript: ENSMUST00000001126
AA Change: I375T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001126
Gene: ENSMUSG00000020829
AA Change: I375T

DomainStartEndE-ValueType
Pfam:MFS_1 29 443 5.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061174
SMART Domains Protein: ENSMUSP00000051059
Gene: ENSMUSG00000050132

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
low complexity region 221 236 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
SAM 409 476 1.46e-19 SMART
SAM 479 548 9.5e-10 SMART
TIR 561 702 6.73e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108287
SMART Domains Protein: ENSMUSP00000103922
Gene: ENSMUSG00000050132

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
low complexity region 221 236 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
SAM 409 476 1.46e-19 SMART
SAM 479 548 2.15e-8 SMART
TIR 601 742 6.73e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146431
AA Change: S91P

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180786
Meta Mutation Damage Score 0.6012 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane proton-coupled folate transporter protein that facilitates the movement of folate and antifolate substrates across cell membranes, optimally in acidic pH environments. This protein is also expressed in the brain and choroid plexus where it transports folates into the central nervous system. This protein further functions as a heme transporter in duodenal enterocytes, and potentially in other tissues like liver and kidney. Its localization to the apical membrane or cytoplasm of intestinal cells is modulated by dietary iron levels. Mutations in this gene are associated with autosomal recessive hereditary folate malabsorption disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating and liver levels of N-homocysteine and total homocysteine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,601,676 (GRCm39) D230G probably benign Het
Abhd13 A G 8: 10,037,561 (GRCm39) I53V probably benign Het
Adgrl2 A C 3: 148,544,821 (GRCm39) probably null Het
Aldh16a1 G A 7: 44,794,088 (GRCm39) A596V probably damaging Het
Aldh3b2 T A 19: 4,029,414 (GRCm39) Y262* probably null Het
Ambn A G 5: 88,615,831 (GRCm39) Q420R possibly damaging Het
Ankib1 A C 5: 3,750,344 (GRCm39) probably benign Het
Arhgap9 C A 10: 127,165,407 (GRCm39) H430Q probably benign Het
Arhgef25 C T 10: 127,019,933 (GRCm39) G435E probably damaging Het
Armc12 A T 17: 28,751,366 (GRCm39) D120V possibly damaging Het
Asxl3 G A 18: 22,649,738 (GRCm39) E576K possibly damaging Het
Bcdin3d T C 15: 99,368,776 (GRCm39) E141G probably benign Het
Bmpr1b G A 3: 141,546,437 (GRCm39) T483M probably damaging Het
Caprin2 C T 6: 148,744,452 (GRCm39) S991N probably damaging Het
Cd96 T C 16: 45,892,129 (GRCm39) I286M possibly damaging Het
Cdcp1 G T 9: 123,009,237 (GRCm39) F480L probably benign Het
Celf5 T C 10: 81,300,243 (GRCm39) T258A probably benign Het
Cgnl1 A G 9: 71,628,939 (GRCm39) V577A probably damaging Het
Clca3b A G 3: 144,547,226 (GRCm39) S304P probably benign Het
Cmya5 A T 13: 93,232,108 (GRCm39) H993Q probably benign Het
Cnbp A T 6: 87,822,746 (GRCm39) C6S probably damaging Het
Col14a1 C T 15: 55,360,907 (GRCm39) R1605W probably damaging Het
Cops7a T C 6: 124,941,817 (GRCm39) N11S probably benign Het
Coro7 T C 16: 4,448,042 (GRCm39) probably benign Het
Cpvl T C 6: 53,909,485 (GRCm39) H217R possibly damaging Het
Cuedc1 T C 11: 88,075,447 (GRCm39) probably benign Het
Cyp2c66 A G 19: 39,130,369 (GRCm39) Y68C probably damaging Het
Dicer1 G A 12: 104,668,710 (GRCm39) T1324M probably benign Het
Dlgap2 A G 8: 14,777,562 (GRCm39) D268G probably benign Het
Dnm1 T A 2: 32,207,001 (GRCm39) M535L possibly damaging Het
Dock7 A T 4: 98,850,517 (GRCm39) F1575Y probably benign Het
Dpp10 T A 1: 123,326,275 (GRCm39) H403L possibly damaging Het
Dync1h1 A G 12: 110,616,285 (GRCm39) D3112G possibly damaging Het
Eno3 A G 11: 70,548,761 (GRCm39) E21G probably null Het
Fam120b T A 17: 15,643,186 (GRCm39) V655D probably damaging Het
Fkbp5 A T 17: 28,647,426 (GRCm39) D136E probably benign Het
Gdap1l1 T A 2: 163,289,573 (GRCm39) Y179* probably null Het
Gfer A G 17: 24,913,277 (GRCm39) W192R probably damaging Het
Gm4782 A G 6: 50,586,838 (GRCm39) T408A probably benign Het
Golgb1 C T 16: 36,695,992 (GRCm39) Q164* probably null Het
Gpnmb A G 6: 49,024,276 (GRCm39) N197S probably damaging Het
Gtf2f1 G A 17: 57,310,802 (GRCm39) T414M probably benign Het
Hc A G 2: 34,926,166 (GRCm39) probably benign Het
Hcfc1 A T X: 72,992,035 (GRCm39) probably benign Het
Helz2 C T 2: 180,872,223 (GRCm39) R2539Q probably damaging Het
Hsd17b12 T A 2: 93,988,160 (GRCm39) I19F probably benign Het
Incenp T C 19: 9,871,114 (GRCm39) T172A unknown Het
Jmy A G 13: 93,578,126 (GRCm39) Y681H probably benign Het
Kbtbd11 A G 8: 15,077,508 (GRCm39) T36A probably benign Het
Kcnh4 T C 11: 100,646,525 (GRCm39) D267G probably damaging Het
Krt34 C T 11: 99,932,157 (GRCm39) E56K probably damaging Het
Krt40 T A 11: 99,429,568 (GRCm39) E335D probably damaging Het
Krt86 T A 15: 101,374,454 (GRCm39) Y282* probably null Het
Lgi3 C T 14: 70,772,255 (GRCm39) R267* probably null Het
Lnpk A G 2: 74,367,633 (GRCm39) probably benign Het
Lrp1b T A 2: 40,888,195 (GRCm39) H2355L probably benign Het
Lrrc8e G A 8: 4,285,401 (GRCm39) R542H probably benign Het
Mia2 T C 12: 59,155,642 (GRCm39) Y452H probably damaging Het
Mmachc C T 4: 116,561,738 (GRCm39) R132Q probably damaging Het
Mtbp T A 15: 55,440,882 (GRCm39) N356K possibly damaging Het
Myo5b A G 18: 74,794,787 (GRCm39) H552R possibly damaging Het
Niban1 A G 1: 151,593,967 (GRCm39) D884G probably benign Het
Noxred1 A G 12: 87,273,753 (GRCm39) V96A probably benign Het
Nr1d2 T A 14: 18,211,933 (GRCm38) D390V possibly damaging Het
Oas1e A T 5: 120,929,839 (GRCm39) probably benign Het
Odad2 A T 18: 7,211,516 (GRCm39) V786D probably damaging Het
Or1r1 T C 11: 73,874,538 (GRCm39) S299G probably benign Het
Or6c1b T A 10: 129,273,217 (GRCm39) Y179N probably damaging Het
Otog G T 7: 45,916,805 (GRCm39) C914F probably damaging Het
Pank2 G T 2: 131,122,117 (GRCm39) C214F probably damaging Het
Pcdhb1 T A 18: 37,399,788 (GRCm39) S580T probably benign Het
Pdia3 T C 2: 121,244,592 (GRCm39) S2P probably damaging Het
Peli1 G T 11: 21,092,602 (GRCm39) R83L probably damaging Het
Pla2g3 T A 11: 3,441,935 (GRCm39) C366* probably null Het
Pon3 T A 6: 5,240,860 (GRCm39) D107V probably benign Het
Ppip5k2 A G 1: 97,668,816 (GRCm39) C532R probably damaging Het
Prph A T 15: 98,953,608 (GRCm39) D174V probably damaging Het
Psd3 A G 8: 68,210,738 (GRCm39) M270T probably damaging Het
Pum3 A G 19: 27,400,155 (GRCm39) probably benign Het
Pus1 A T 5: 110,927,664 (GRCm39) H30Q probably benign Het
Pwwp3a T C 10: 80,070,092 (GRCm39) S354P probably benign Het
Rab7 A T 6: 87,982,114 (GRCm39) V87E probably damaging Het
Rbm5 A T 9: 107,628,907 (GRCm39) probably benign Het
Reln A G 5: 22,147,595 (GRCm39) probably null Het
S1pr3 A G 13: 51,572,938 (GRCm39) T40A probably benign Het
Sdk1 T A 5: 142,129,677 (GRCm39) probably benign Het
Senp7 T A 16: 55,999,884 (GRCm39) I853N probably damaging Het
Serpinb6c T A 13: 34,083,230 (GRCm39) probably benign Het
Shroom1 T G 11: 53,356,312 (GRCm39) probably null Het
Slc24a3 T C 2: 145,448,584 (GRCm39) I376T probably benign Het
Slc4a9 T C 18: 36,666,733 (GRCm39) F527S probably damaging Het
Slc4a9 T A 18: 36,674,286 (GRCm39) I924N probably damaging Het
Slx4 T A 16: 3,804,816 (GRCm39) E666V probably damaging Het
Snrnp27 G A 6: 86,652,575 (GRCm39) probably benign Het
Sorcs1 C T 19: 50,216,659 (GRCm39) G640E probably damaging Het
Spmap2l G T 5: 77,164,152 (GRCm39) E52* probably null Het
Sptan1 A T 2: 29,908,413 (GRCm39) M1725L probably benign Het
Sync G A 4: 129,187,514 (GRCm39) R182K probably damaging Het
Syne2 G A 12: 76,144,808 (GRCm39) G1586S probably damaging Het
Sytl1 G T 4: 132,980,768 (GRCm39) T522K probably damaging Het
Tex2 T A 11: 106,410,781 (GRCm39) K414* probably null Het
Tex55 C T 16: 38,644,929 (GRCm39) probably benign Het
Thsd7a G A 6: 12,503,915 (GRCm39) T413I probably benign Het
Tm9sf1 C T 14: 55,875,392 (GRCm39) A451T possibly damaging Het
Ttn A T 2: 76,656,496 (GRCm39) probably benign Het
Uba2 T C 7: 33,854,054 (GRCm39) I140V possibly damaging Het
Ushbp1 C A 8: 71,842,762 (GRCm39) G361* probably null Het
Wbp2nl C T 15: 82,197,988 (GRCm39) A175V probably benign Het
Zc3h12d A G 10: 7,738,330 (GRCm39) E212G probably damaging Het
Zc3h7b T C 15: 81,653,031 (GRCm39) probably benign Het
Other mutations in Slc46a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0242:Slc46a1 UTSW 11 78,359,493 (GRCm39) missense possibly damaging 0.58
R0255:Slc46a1 UTSW 11 78,361,625 (GRCm39) missense probably damaging 1.00
R1356:Slc46a1 UTSW 11 78,361,550 (GRCm39) missense probably benign 0.16
R2088:Slc46a1 UTSW 11 78,359,471 (GRCm39) missense possibly damaging 0.81
R2273:Slc46a1 UTSW 11 78,357,249 (GRCm39) missense probably benign 0.00
R2274:Slc46a1 UTSW 11 78,357,249 (GRCm39) missense probably benign 0.00
R2275:Slc46a1 UTSW 11 78,357,249 (GRCm39) missense probably benign 0.00
R4627:Slc46a1 UTSW 11 78,357,715 (GRCm39) missense probably benign 0.05
R4682:Slc46a1 UTSW 11 78,359,502 (GRCm39) missense possibly damaging 0.85
R5513:Slc46a1 UTSW 11 78,357,376 (GRCm39) missense probably benign 0.38
R5739:Slc46a1 UTSW 11 78,357,975 (GRCm39) missense possibly damaging 0.95
R6033:Slc46a1 UTSW 11 78,356,833 (GRCm39) critical splice donor site probably null
R6033:Slc46a1 UTSW 11 78,356,833 (GRCm39) critical splice donor site probably null
R6351:Slc46a1 UTSW 11 78,357,985 (GRCm39) missense probably benign 0.13
R6807:Slc46a1 UTSW 11 78,357,790 (GRCm39) missense probably damaging 0.96
R6885:Slc46a1 UTSW 11 78,357,805 (GRCm39) missense probably benign 0.04
R7454:Slc46a1 UTSW 11 78,357,337 (GRCm39) missense probably damaging 0.97
R8425:Slc46a1 UTSW 11 78,359,471 (GRCm39) missense possibly damaging 0.81
R8772:Slc46a1 UTSW 11 78,356,777 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AACTCCAAAGCGCAGGTTCATTTTC -3'
(R):5'- GGTGTCATCGCACCCATTTTCCAG -3'

Sequencing Primer
(F):5'- GCTCTCATTCAAAAGATTGGGCAG -3'
(R):5'- ttccagatgggaaagaagagg -3'
Posted On 2013-07-11