Incidental Mutation 'R7730:Psat1'
ID595798
Institutional Source Beutler Lab
Gene Symbol Psat1
Ensembl Gene ENSMUSG00000024640
Gene Namephosphoserine aminotransferase 1
SynonymsD8Ertd814e, PSA, EPIP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location15904678-15947337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15918356 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 83 (F83L)
Ref Sequence ENSEMBL: ENSMUSP00000025542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025542] [ENSMUST00000162053] [ENSMUST00000162416]
Predicted Effect probably damaging
Transcript: ENSMUST00000025542
AA Change: F83L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025542
Gene: ENSMUSG00000024640
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Aminotran_5 7 357 1.3e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162053
AA Change: F80L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125340
Gene: ENSMUSG00000024640
AA Change: F80L

DomainStartEndE-ValueType
Pfam:Aminotran_5 10 354 1.1e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162416
AA Change: F42L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125593
Gene: ENSMUSG00000024640
AA Change: F42L

DomainStartEndE-ValueType
Pfam:Aminotran_5 1 157 6.5e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-V pyridoxal-phosphate-dependent aminotransferase family. The encoded protein is a phosphoserine aminotransferase and decreased expression may be associated with schizophrenia. Mutations in this gene are also associated with phosphoserine aminotransferase deficiency. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 1, 3, and 8. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit craniofacial defects, exencephaly and growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Psat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03017:Psat1 APN 19 15917135 missense possibly damaging 0.52
IGL03102:Psat1 APN 19 15906123 missense probably damaging 1.00
R1617:Psat1 UTSW 19 15924302 critical splice donor site probably null
R1758:Psat1 UTSW 19 15914879 missense probably damaging 1.00
R3897:Psat1 UTSW 19 15919453 critical splice donor site probably null
R5138:Psat1 UTSW 19 15914948 missense possibly damaging 0.77
R6899:Psat1 UTSW 19 15918205 critical splice donor site probably null
R6941:Psat1 UTSW 19 15920943 missense probably damaging 1.00
R6945:Psat1 UTSW 19 15917181 missense probably benign 0.30
R7268:Psat1 UTSW 19 15917144 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTGCATCTTCAGTTCCCAGAAC -3'
(R):5'- GCAAAGTGATAGTGAGACTTTACC -3'

Sequencing Primer
(F):5'- GTTCCCAGAACTTACTTGTGTAAC -3'
(R):5'- AGATGAGTCAGTGCTCTTAACCGC -3'
Posted On2019-11-12