Incidental Mutation 'R7731:Myo3a'
ID595804
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Namemyosin IIIA
Synonyms9030416P08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7731 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location22227503-22618252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22282589 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 179 (V179M)
Ref Sequence ENSEMBL: ENSMUSP00000046329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]
Predicted Effect probably damaging
Transcript: ENSMUST00000044749
AA Change: V179M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: V179M

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153002
AA Change: V171M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716
AA Change: V171M

DomainStartEndE-ValueType
S_TKc 21 287 1.62e-91 SMART
MYSc 332 753 3.06e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik C T 16: 13,677,759 R241C probably damaging Het
A430078G23Rik G A 8: 3,384,936 V194M probably damaging Het
A4gnt A G 9: 99,620,417 E210G possibly damaging Het
Accsl T C 2: 93,861,018 T372A probably benign Het
Adgrf5 T A 17: 43,450,560 S1049T probably damaging Het
Agmo G A 12: 37,414,940 R405K probably benign Het
Akap3 A G 6: 126,865,068 T217A probably benign Het
Ankfy1 T A 11: 72,712,281 N45K probably benign Het
Ankrd11 G A 8: 122,895,433 T560I probably benign Het
Aqp1 T C 6: 55,345,819 Y186H possibly damaging Het
Arnt T C 3: 95,483,775 V320A probably benign Het
B230217C12Rik T C 11: 97,841,400 L2P unknown Het
Bco1 C A 8: 117,131,068 S477R possibly damaging Het
Brd4 A G 17: 32,211,224 S703P possibly damaging Het
Ceacam3 T A 7: 17,158,350 N339K Het
Cebpb A G 2: 167,689,206 D62G probably damaging Het
Clca4a T C 3: 144,952,785 I890V probably benign Het
Cyp2d9 A G 15: 82,455,432 probably null Het
Cyth1 T C 11: 118,169,053 T374A possibly damaging Het
Dennd3 A T 15: 73,562,367 H962L probably damaging Het
Dhtkd1 T G 2: 5,924,112 L249F probably benign Het
Dnah7b T A 1: 46,139,745 H859Q probably benign Het
E2f4 A G 8: 105,298,633 D115G probably damaging Het
Exoc3l4 G C 12: 111,430,748 D688H possibly damaging Het
Fan1 C T 7: 64,372,696 V270I probably benign Het
Fat2 A T 11: 55,310,706 I514N probably damaging Het
Fndc1 G A 17: 7,773,439 T475I unknown Het
Fstl5 T A 3: 76,661,762 I574N probably damaging Het
Fzd4 T C 7: 89,408,050 V435A possibly damaging Het
Fzd6 T C 15: 39,033,932 F492S probably damaging Het
Gm4924 T A 10: 82,377,527 N386K unknown Het
Gm8994 A G 6: 136,328,873 I111V probably benign Het
Hbp1 A T 12: 31,933,368 D362E possibly damaging Het
Hectd4 A C 5: 121,307,014 M105L probably benign Het
Hivep2 C T 10: 14,149,714 P2424L probably benign Het
Hspa4 A T 11: 53,266,964 probably null Het
Igf2bp3 A G 6: 49,134,731 V122A probably damaging Het
Ikzf2 A T 1: 69,539,143 N402K possibly damaging Het
Ip6k1 T C 9: 108,044,728 F207S probably damaging Het
Kbtbd8 C A 6: 95,118,578 N24K probably benign Het
Krtap10-4 T G 10: 77,826,820 T75P unknown Het
Macf1 C A 4: 123,444,879 S4355I probably benign Het
Muc5b A T 7: 141,857,305 probably null Het
Nup210 G T 6: 91,071,888 T462K possibly damaging Het
Olfr1106 T C 2: 87,049,234 M1V probably null Het
Olfr365 A G 2: 37,201,549 M103V probably benign Het
Olfr561 A G 7: 102,774,934 I137V probably benign Het
Olfr743 T A 14: 50,533,684 S91T probably damaging Het
Olfr920 A G 9: 38,756,246 Q186R possibly damaging Het
Ostn G A 16: 27,346,918 R119Q probably damaging Het
Pcdhga11 A T 18: 37,756,511 N191Y probably benign Het
Pcsk6 A T 7: 66,033,893 Q752L probably benign Het
Pfas T C 11: 69,000,045 T347A probably damaging Het
Pkd1 A T 17: 24,573,898 R1520W probably damaging Het
Prpf8 T C 11: 75,508,906 S2264P probably damaging Het
Ptcd1 C A 5: 145,151,364 R612S probably benign Het
Ptch2 T A 4: 117,108,295 F359Y probably benign Het
Ptprr A C 10: 116,237,295 D474A probably damaging Het
Pum1 C A 4: 130,762,963 Q846K probably benign Het
Slc22a14 C T 9: 119,170,611 A505T possibly damaging Het
Smpdl3a A G 10: 57,802,554 Y151C probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Sptlc1 A G 13: 53,333,957 V450A probably benign Het
Sqle A G 15: 59,315,972 Y43C probably benign Het
Srgap3 T C 6: 112,766,897 H460R probably benign Het
Syt15 A T 14: 34,223,067 E190D possibly damaging Het
Tbc1d10b T C 7: 127,198,821 K716R probably benign Het
Tbx20 T C 9: 24,770,697 I120M probably damaging Het
Tgm1 T G 14: 55,710,521 I274L probably benign Het
Tmem156 C T 5: 65,075,562 probably null Het
Tnk2 A G 16: 32,670,134 D264G possibly damaging Het
Tsc22d4 A G 5: 137,758,694 S306G possibly damaging Het
Tut1 T A 19: 8,959,262 V150D probably benign Het
Uchl5 T C 1: 143,794,537 F143L Het
Vmn1r23 T C 6: 57,926,334 K153R probably benign Het
Zfp236 A T 18: 82,680,673 D94E probably benign Het
Zfp759 T C 13: 67,139,626 Y414H possibly damaging Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
lose UTSW 2 22558320 nonsense probably null
snooze UTSW 2 22282634 missense probably damaging 0.99
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense possibly damaging 0.78
R7301:Myo3a UTSW 2 22544466 critical splice donor site probably null
R7318:Myo3a UTSW 2 22558320 nonsense probably null
R7447:Myo3a UTSW 2 22544426 missense probably benign 0.27
R7456:Myo3a UTSW 2 22407444 missense probably benign 0.08
R7528:Myo3a UTSW 2 22266114 nonsense probably null
R7768:Myo3a UTSW 2 22241143 missense probably damaging 0.99
R8054:Myo3a UTSW 2 22574317 missense probably benign 0.00
R8140:Myo3a UTSW 2 22407346 missense probably damaging 1.00
R8143:Myo3a UTSW 2 22282665 critical splice donor site probably null
R8346:Myo3a UTSW 2 22558422 critical splice donor site probably null
R8421:Myo3a UTSW 2 22362124 missense probably benign 0.07
Z1177:Myo3a UTSW 2 22618140 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTCACACAGGGCTTACAGTTG -3'
(R):5'- TGGTATAGTCCAACACATTTAGGG -3'

Sequencing Primer
(F):5'- CACACAGGGCTTACAGTTGTATAG -3'
(R):5'- TAGTCCAACACATTTAGGGAGAAAAG -3'
Posted On2019-11-12