Incidental Mutation 'R7731:Clca4a'
ID 595813
Institutional Source Beutler Lab
Gene Symbol Clca4a
Ensembl Gene ENSMUSG00000068547
Gene Name chloride channel accessory 4A
Synonyms Clca6, 9130020L07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock # R7731 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144952480-144975045 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144952785 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 890 (I890V)
Ref Sequence ENSEMBL: ENSMUSP00000029923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029923]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029923
AA Change: I890V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029923
Gene: ENSMUSG00000068547
AA Change: I890V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
VWA 306 480 5.94e-16 SMART
Blast:VWA 513 552 7e-18 BLAST
Blast:FN3 757 838 8e-33 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik C T 16: 13,677,759 R241C probably damaging Het
A430078G23Rik G A 8: 3,384,936 V194M probably damaging Het
A4gnt A G 9: 99,620,417 E210G possibly damaging Het
Accsl T C 2: 93,861,018 T372A probably benign Het
Adgrf5 T A 17: 43,450,560 S1049T probably damaging Het
Agmo G A 12: 37,414,940 R405K probably benign Het
Akap3 A G 6: 126,865,068 T217A probably benign Het
Ankfy1 T A 11: 72,712,281 N45K probably benign Het
Ankrd11 G A 8: 122,895,433 T560I probably benign Het
Aqp1 T C 6: 55,345,819 Y186H possibly damaging Het
Arnt T C 3: 95,483,775 V320A probably benign Het
B230217C12Rik T C 11: 97,841,400 L2P unknown Het
Bco1 C A 8: 117,131,068 S477R possibly damaging Het
Brd4 A G 17: 32,211,224 S703P possibly damaging Het
Ceacam3 T A 7: 17,158,350 N339K Het
Cebpb A G 2: 167,689,206 D62G probably damaging Het
Cyp2d9 A G 15: 82,455,432 probably null Het
Cyth1 T C 11: 118,169,053 T374A possibly damaging Het
Dennd3 A T 15: 73,562,367 H962L probably damaging Het
Dhtkd1 T G 2: 5,924,112 L249F probably benign Het
Dnah7b T A 1: 46,139,745 H859Q probably benign Het
E2f4 A G 8: 105,298,633 D115G probably damaging Het
Exoc3l4 G C 12: 111,430,748 D688H possibly damaging Het
Fan1 C T 7: 64,372,696 V270I probably benign Het
Fat2 A T 11: 55,310,706 I514N probably damaging Het
Fndc1 G A 17: 7,773,439 T475I unknown Het
Fstl5 T A 3: 76,661,762 I574N probably damaging Het
Fzd4 T C 7: 89,408,050 V435A possibly damaging Het
Fzd6 T C 15: 39,033,932 F492S probably damaging Het
Gm4924 T A 10: 82,377,527 N386K unknown Het
Gm8994 A G 6: 136,328,873 I111V probably benign Het
Hbp1 A T 12: 31,933,368 D362E possibly damaging Het
Hectd4 A C 5: 121,307,014 M105L probably benign Het
Hivep2 C T 10: 14,149,714 P2424L probably benign Het
Hspa4 A T 11: 53,266,964 probably null Het
Igf2bp3 A G 6: 49,134,731 V122A probably damaging Het
Ikzf2 A T 1: 69,539,143 N402K possibly damaging Het
Ip6k1 T C 9: 108,044,728 F207S probably damaging Het
Kbtbd8 C A 6: 95,118,578 N24K probably benign Het
Krtap10-4 T G 10: 77,826,820 T75P unknown Het
Macf1 C A 4: 123,444,879 S4355I probably benign Het
Muc5b A T 7: 141,857,305 probably null Het
Myo3a G A 2: 22,282,589 V179M probably damaging Het
Nup210 G T 6: 91,071,888 T462K possibly damaging Het
Olfr1106 T C 2: 87,049,234 M1V probably null Het
Olfr365 A G 2: 37,201,549 M103V probably benign Het
Olfr561 A G 7: 102,774,934 I137V probably benign Het
Olfr743 T A 14: 50,533,684 S91T probably damaging Het
Olfr920 A G 9: 38,756,246 Q186R possibly damaging Het
Ostn G A 16: 27,346,918 R119Q probably damaging Het
Pcdhga11 A T 18: 37,756,511 N191Y probably benign Het
Pcsk6 A T 7: 66,033,893 Q752L probably benign Het
Pfas T C 11: 69,000,045 T347A probably damaging Het
Pkd1 A T 17: 24,573,898 R1520W probably damaging Het
Prpf8 T C 11: 75,508,906 S2264P probably damaging Het
Ptcd1 C A 5: 145,151,364 R612S probably benign Het
Ptch2 T A 4: 117,108,295 F359Y probably benign Het
Ptprr A C 10: 116,237,295 D474A probably damaging Het
Pum1 C A 4: 130,762,963 Q846K probably benign Het
Slc22a14 C T 9: 119,170,611 A505T possibly damaging Het
Smpdl3a A G 10: 57,802,554 Y151C probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Sptlc1 A G 13: 53,333,957 V450A probably benign Het
Sqle A G 15: 59,315,972 Y43C probably benign Het
Srgap3 T C 6: 112,766,897 H460R probably benign Het
Syt15 A T 14: 34,223,067 E190D possibly damaging Het
Tbc1d10b T C 7: 127,198,821 K716R probably benign Het
Tbx20 T C 9: 24,770,697 I120M probably damaging Het
Tgm1 T G 14: 55,710,521 I274L probably benign Het
Tmem156 C T 5: 65,075,562 probably null Het
Tnk2 A G 16: 32,670,134 D264G possibly damaging Het
Tsc22d4 A G 5: 137,758,694 S306G possibly damaging Het
Tut1 T A 19: 8,959,262 V150D probably benign Het
Uchl5 T C 1: 143,794,537 F143L Het
Vmn1r23 T C 6: 57,926,334 K153R probably benign Het
Zfp236 A T 18: 82,680,673 D94E probably benign Het
Zfp759 T C 13: 67,139,626 Y414H possibly damaging Het
Other mutations in Clca4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Clca4a APN 3 144954939 missense probably damaging 0.99
IGL01139:Clca4a APN 3 144966269 missense probably damaging 0.99
IGL01371:Clca4a APN 3 144960672 missense probably damaging 1.00
IGL01609:Clca4a APN 3 144953780 missense probably damaging 1.00
IGL01998:Clca4a APN 3 144958126 missense probably damaging 0.98
IGL02172:Clca4a APN 3 144970394 nonsense probably null
IGL02217:Clca4a APN 3 144961996 missense possibly damaging 0.61
IGL02514:Clca4a APN 3 144955071 missense probably damaging 1.00
IGL02975:Clca4a APN 3 144963769 missense possibly damaging 0.90
IGL03025:Clca4a APN 3 144957318 missense probably benign 0.07
IGL03049:Clca4a APN 3 144970755 splice site probably benign
IGL03058:Clca4a APN 3 144961834 splice site probably benign
IGL03259:Clca4a APN 3 144958080 missense probably damaging 1.00
IGL03263:Clca4a APN 3 144966431 missense probably damaging 1.00
IGL03334:Clca4a APN 3 144953866 missense probably benign 0.28
PIT4142001:Clca4a UTSW 3 144968311 missense probably damaging 1.00
R0201:Clca4a UTSW 3 144960717 missense probably benign 0.00
R0316:Clca4a UTSW 3 144953764 missense probably damaging 1.00
R0524:Clca4a UTSW 3 144969393 missense probably damaging 1.00
R0680:Clca4a UTSW 3 144969367 missense probably damaging 1.00
R0688:Clca4a UTSW 3 144961974 missense probably damaging 1.00
R1137:Clca4a UTSW 3 144970685 missense probably damaging 1.00
R1568:Clca4a UTSW 3 144952929 missense probably benign 0.00
R1719:Clca4a UTSW 3 144963755 missense probably damaging 1.00
R2055:Clca4a UTSW 3 144970728 missense probably damaging 1.00
R3078:Clca4a UTSW 3 144968253 missense probably damaging 0.99
R3080:Clca4a UTSW 3 144963790 missense probably damaging 1.00
R3789:Clca4a UTSW 3 144974956 missense probably damaging 1.00
R3881:Clca4a UTSW 3 144957318 missense probably benign 0.07
R4133:Clca4a UTSW 3 144969352 missense probably benign 0.07
R4402:Clca4a UTSW 3 144952848 missense probably benign 0.08
R4455:Clca4a UTSW 3 144957259 missense probably damaging 1.00
R4577:Clca4a UTSW 3 144954969 missense probably damaging 0.97
R4683:Clca4a UTSW 3 144954940 missense probably damaging 1.00
R5135:Clca4a UTSW 3 144954946 missense probably damaging 1.00
R5267:Clca4a UTSW 3 144953812 missense probably damaging 1.00
R5345:Clca4a UTSW 3 144970461 missense probably damaging 1.00
R6311:Clca4a UTSW 3 144966413 missense probably damaging 0.99
R6492:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6493:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6494:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6861:Clca4a UTSW 3 144970655 missense probably benign
R7102:Clca4a UTSW 3 144961909 missense probably benign 0.01
R7133:Clca4a UTSW 3 144961890 nonsense probably null
R7171:Clca4a UTSW 3 144958173 missense probably benign
R7516:Clca4a UTSW 3 144966248 missense probably damaging 1.00
R7642:Clca4a UTSW 3 144953751 missense probably benign 0.11
R7787:Clca4a UTSW 3 144953833 missense probably benign
R7820:Clca4a UTSW 3 144960671 missense probably damaging 1.00
R7895:Clca4a UTSW 3 144968405 missense probably benign 0.19
R7991:Clca4a UTSW 3 144952739 missense possibly damaging 0.75
R8240:Clca4a UTSW 3 144970727 missense probably damaging 1.00
R9308:Clca4a UTSW 3 144970422 missense probably damaging 1.00
R9373:Clca4a UTSW 3 144966372 missense possibly damaging 0.66
R9488:Clca4a UTSW 3 144953771 missense probably damaging 1.00
R9772:Clca4a UTSW 3 144970661 missense probably damaging 1.00
R9781:Clca4a UTSW 3 144961952 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACCCTCTTGAAGTTACTTTTGAG -3'
(R):5'- CAACTCCGAGGAAACCTTTGC -3'

Sequencing Primer
(F):5'- GAAGTTACTTTTGAGTTCATGATGAC -3'
(R):5'- GAGGAAACCTTTGCCTTTAAACCAG -3'
Posted On 2019-11-12