Incidental Mutation 'R7731:Vmn1r23'
ID595823
Institutional Source Beutler Lab
Gene Symbol Vmn1r23
Ensembl Gene ENSMUSG00000093376
Gene Namevomeronasal 1 receptor 23
SynonymsV1rc24
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7731 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location57925842-57926838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57926334 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 153 (K153R)
Ref Sequence ENSEMBL: ENSMUSP00000135676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175817]
Predicted Effect probably benign
Transcript: ENSMUST00000175817
AA Change: K153R

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135676
Gene: ENSMUSG00000093376
AA Change: K153R

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.1e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik C T 16: 13,677,759 R241C probably damaging Het
A430078G23Rik G A 8: 3,384,936 V194M probably damaging Het
A4gnt A G 9: 99,620,417 E210G possibly damaging Het
Accsl T C 2: 93,861,018 T372A probably benign Het
Adgrf5 T A 17: 43,450,560 S1049T probably damaging Het
Agmo G A 12: 37,414,940 R405K probably benign Het
Akap3 A G 6: 126,865,068 T217A probably benign Het
Ankfy1 T A 11: 72,712,281 N45K probably benign Het
Ankrd11 G A 8: 122,895,433 T560I probably benign Het
Aqp1 T C 6: 55,345,819 Y186H possibly damaging Het
Arnt T C 3: 95,483,775 V320A probably benign Het
B230217C12Rik T C 11: 97,841,400 L2P unknown Het
Bco1 C A 8: 117,131,068 S477R possibly damaging Het
Brd4 A G 17: 32,211,224 S703P possibly damaging Het
Ceacam3 T A 7: 17,158,350 N339K Het
Cebpb A G 2: 167,689,206 D62G probably damaging Het
Clca4a T C 3: 144,952,785 I890V probably benign Het
Cyp2d9 A G 15: 82,455,432 probably null Het
Cyth1 T C 11: 118,169,053 T374A possibly damaging Het
Dennd3 A T 15: 73,562,367 H962L probably damaging Het
Dhtkd1 T G 2: 5,924,112 L249F probably benign Het
Dnah7b T A 1: 46,139,745 H859Q probably benign Het
E2f4 A G 8: 105,298,633 D115G probably damaging Het
Exoc3l4 G C 12: 111,430,748 D688H possibly damaging Het
Fan1 C T 7: 64,372,696 V270I probably benign Het
Fat2 A T 11: 55,310,706 I514N probably damaging Het
Fndc1 G A 17: 7,773,439 T475I unknown Het
Fstl5 T A 3: 76,661,762 I574N probably damaging Het
Fzd4 T C 7: 89,408,050 V435A possibly damaging Het
Fzd6 T C 15: 39,033,932 F492S probably damaging Het
Gm4924 T A 10: 82,377,527 N386K unknown Het
Gm8994 A G 6: 136,328,873 I111V probably benign Het
Hbp1 A T 12: 31,933,368 D362E possibly damaging Het
Hectd4 A C 5: 121,307,014 M105L probably benign Het
Hivep2 C T 10: 14,149,714 P2424L probably benign Het
Hspa4 A T 11: 53,266,964 probably null Het
Igf2bp3 A G 6: 49,134,731 V122A probably damaging Het
Ikzf2 A T 1: 69,539,143 N402K possibly damaging Het
Ip6k1 T C 9: 108,044,728 F207S probably damaging Het
Kbtbd8 C A 6: 95,118,578 N24K probably benign Het
Krtap10-4 T G 10: 77,826,820 T75P unknown Het
Macf1 C A 4: 123,444,879 S4355I probably benign Het
Muc5b A T 7: 141,857,305 probably null Het
Myo3a G A 2: 22,282,589 V179M probably damaging Het
Nup210 G T 6: 91,071,888 T462K possibly damaging Het
Olfr1106 T C 2: 87,049,234 M1V probably null Het
Olfr365 A G 2: 37,201,549 M103V probably benign Het
Olfr561 A G 7: 102,774,934 I137V probably benign Het
Olfr743 T A 14: 50,533,684 S91T probably damaging Het
Olfr920 A G 9: 38,756,246 Q186R possibly damaging Het
Ostn G A 16: 27,346,918 R119Q probably damaging Het
Pcdhga11 A T 18: 37,756,511 N191Y probably benign Het
Pcsk6 A T 7: 66,033,893 Q752L probably benign Het
Pfas T C 11: 69,000,045 T347A probably damaging Het
Pkd1 A T 17: 24,573,898 R1520W probably damaging Het
Prpf8 T C 11: 75,508,906 S2264P probably damaging Het
Ptcd1 C A 5: 145,151,364 R612S probably benign Het
Ptch2 T A 4: 117,108,295 F359Y probably benign Het
Ptprr A C 10: 116,237,295 D474A probably damaging Het
Pum1 C A 4: 130,762,963 Q846K probably benign Het
Slc22a14 C T 9: 119,170,611 A505T possibly damaging Het
Smpdl3a A G 10: 57,802,554 Y151C probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Sptlc1 A G 13: 53,333,957 V450A probably benign Het
Sqle A G 15: 59,315,972 Y43C probably benign Het
Srgap3 T C 6: 112,766,897 H460R probably benign Het
Syt15 A T 14: 34,223,067 E190D possibly damaging Het
Tbc1d10b T C 7: 127,198,821 K716R probably benign Het
Tbx20 T C 9: 24,770,697 I120M probably damaging Het
Tgm1 T G 14: 55,710,521 I274L probably benign Het
Tmem156 C T 5: 65,075,562 probably null Het
Tnk2 A G 16: 32,670,134 D264G possibly damaging Het
Tsc22d4 A G 5: 137,758,694 S306G possibly damaging Het
Tut1 T A 19: 8,959,262 V150D probably benign Het
Uchl5 T C 1: 143,794,537 F143L Het
Zfp236 A T 18: 82,680,673 D94E probably benign Het
Zfp759 T C 13: 67,139,626 Y414H possibly damaging Het
Other mutations in Vmn1r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Vmn1r23 APN 6 57926076 missense possibly damaging 0.89
IGL01980:Vmn1r23 APN 6 57926490 missense probably damaging 1.00
IGL02934:Vmn1r23 APN 6 57925929 missense probably benign 0.26
IGL03153:Vmn1r23 APN 6 57925932 missense probably damaging 0.98
R0410:Vmn1r23 UTSW 6 57926190 missense probably benign 0.11
R0452:Vmn1r23 UTSW 6 57926484 missense possibly damaging 0.90
R0590:Vmn1r23 UTSW 6 57926364 missense probably benign 0.43
R0647:Vmn1r23 UTSW 6 57926184 missense probably benign
R0692:Vmn1r23 UTSW 6 57926125 nonsense probably null
R1674:Vmn1r23 UTSW 6 57926061 missense possibly damaging 0.75
R1744:Vmn1r23 UTSW 6 57925925 missense possibly damaging 0.81
R1774:Vmn1r23 UTSW 6 57926690 missense probably damaging 0.97
R2101:Vmn1r23 UTSW 6 57926452 missense possibly damaging 0.90
R2202:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R2204:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R2205:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R4282:Vmn1r23 UTSW 6 57926467 missense probably benign 0.27
R4408:Vmn1r23 UTSW 6 57926368 missense probably benign 0.01
R4532:Vmn1r23 UTSW 6 57925929 missense probably benign 0.21
R4690:Vmn1r23 UTSW 6 57926025 missense probably benign
R4700:Vmn1r23 UTSW 6 57926205 missense probably benign 0.17
R4894:Vmn1r23 UTSW 6 57926325 missense probably benign 0.00
R6164:Vmn1r23 UTSW 6 57926055 missense possibly damaging 0.90
R6930:Vmn1r23 UTSW 6 57926145 missense probably benign
R7129:Vmn1r23 UTSW 6 57926076 missense possibly damaging 0.89
R7877:Vmn1r23 UTSW 6 57926556 missense probably benign
R7960:Vmn1r23 UTSW 6 57926556 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTCAGGGGATGCTCTCAG -3'
(R):5'- ACTCTCTATGGGCATCACATG -3'

Sequencing Primer
(F):5'- CCTGATGCTATGAAGATGCTTGC -3'
(R):5'- ATCACATGCCTCCTGAGTGTG -3'
Posted On2019-11-12