Incidental Mutation 'R7731:Hivep2'
ID595845
Institutional Source Beutler Lab
Gene Symbol Hivep2
Ensembl Gene ENSMUSG00000015501
Gene Namehuman immunodeficiency virus type I enhancer binding protein 2
SynonymsShn-2, MIBP1, Schnurri-2, Gm20114
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R7731 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location13966075-14151374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14149714 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 2424 (P2424L)
Ref Sequence ENSEMBL: ENSMUSP00000015645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015645] [ENSMUST00000187083] [ENSMUST00000191138]
Predicted Effect probably benign
Transcript: ENSMUST00000015645
AA Change: P2424L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015645
Gene: ENSMUSG00000015501
AA Change: P2424L

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187083
AA Change: P2424L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140290
Gene: ENSMUSG00000015501
AA Change: P2424L

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191138
AA Change: P2424L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140150
Gene: ENSMUSG00000015501
AA Change: P2424L

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of closely related, large, zinc finger-containing transcription factors. The encoded protein regulates transcription by binding to regulatory regions of various cellular and viral genes that maybe involved in growth, development and metastasis. The protein contains the ZAS domain comprised of two widely separated regions of zinc finger motifs, a stretch of highly acidic amino acids and a serine/threonine-rich sequence. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display abnormal thymus anatomy, severely defective positive selection of CD4+ and CD8+ cells, and enhanced T-helper 2 cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik C T 16: 13,677,759 R241C probably damaging Het
A430078G23Rik G A 8: 3,384,936 V194M probably damaging Het
A4gnt A G 9: 99,620,417 E210G possibly damaging Het
Accsl T C 2: 93,861,018 T372A probably benign Het
Adgrf5 T A 17: 43,450,560 S1049T probably damaging Het
Agmo G A 12: 37,414,940 R405K probably benign Het
Akap3 A G 6: 126,865,068 T217A probably benign Het
Ankfy1 T A 11: 72,712,281 N45K probably benign Het
Ankrd11 G A 8: 122,895,433 T560I probably benign Het
Aqp1 T C 6: 55,345,819 Y186H possibly damaging Het
Arnt T C 3: 95,483,775 V320A probably benign Het
B230217C12Rik T C 11: 97,841,400 L2P unknown Het
Bco1 C A 8: 117,131,068 S477R possibly damaging Het
Brd4 A G 17: 32,211,224 S703P possibly damaging Het
Ceacam3 T A 7: 17,158,350 N339K Het
Cebpb A G 2: 167,689,206 D62G probably damaging Het
Clca4a T C 3: 144,952,785 I890V probably benign Het
Cyp2d9 A G 15: 82,455,432 probably null Het
Cyth1 T C 11: 118,169,053 T374A possibly damaging Het
Dennd3 A T 15: 73,562,367 H962L probably damaging Het
Dhtkd1 T G 2: 5,924,112 L249F probably benign Het
Dnah7b T A 1: 46,139,745 H859Q probably benign Het
E2f4 A G 8: 105,298,633 D115G probably damaging Het
Exoc3l4 G C 12: 111,430,748 D688H possibly damaging Het
Fan1 C T 7: 64,372,696 V270I probably benign Het
Fat2 A T 11: 55,310,706 I514N probably damaging Het
Fndc1 G A 17: 7,773,439 T475I unknown Het
Fstl5 T A 3: 76,661,762 I574N probably damaging Het
Fzd4 T C 7: 89,408,050 V435A possibly damaging Het
Fzd6 T C 15: 39,033,932 F492S probably damaging Het
Gm4924 T A 10: 82,377,527 N386K unknown Het
Gm8994 A G 6: 136,328,873 I111V probably benign Het
Hbp1 A T 12: 31,933,368 D362E possibly damaging Het
Hectd4 A C 5: 121,307,014 M105L probably benign Het
Hspa4 A T 11: 53,266,964 probably null Het
Igf2bp3 A G 6: 49,134,731 V122A probably damaging Het
Ikzf2 A T 1: 69,539,143 N402K possibly damaging Het
Ip6k1 T C 9: 108,044,728 F207S probably damaging Het
Kbtbd8 C A 6: 95,118,578 N24K probably benign Het
Krtap10-4 T G 10: 77,826,820 T75P unknown Het
Macf1 C A 4: 123,444,879 S4355I probably benign Het
Muc5b A T 7: 141,857,305 probably null Het
Myo3a G A 2: 22,282,589 V179M probably damaging Het
Nup210 G T 6: 91,071,888 T462K possibly damaging Het
Olfr1106 T C 2: 87,049,234 M1V probably null Het
Olfr365 A G 2: 37,201,549 M103V probably benign Het
Olfr561 A G 7: 102,774,934 I137V probably benign Het
Olfr743 T A 14: 50,533,684 S91T probably damaging Het
Olfr920 A G 9: 38,756,246 Q186R possibly damaging Het
Ostn G A 16: 27,346,918 R119Q probably damaging Het
Pcdhga11 A T 18: 37,756,511 N191Y probably benign Het
Pcsk6 A T 7: 66,033,893 Q752L probably benign Het
Pfas T C 11: 69,000,045 T347A probably damaging Het
Pkd1 A T 17: 24,573,898 R1520W probably damaging Het
Prpf8 T C 11: 75,508,906 S2264P probably damaging Het
Ptcd1 C A 5: 145,151,364 R612S probably benign Het
Ptch2 T A 4: 117,108,295 F359Y probably benign Het
Ptprr A C 10: 116,237,295 D474A probably damaging Het
Pum1 C A 4: 130,762,963 Q846K probably benign Het
Slc22a14 C T 9: 119,170,611 A505T possibly damaging Het
Smpdl3a A G 10: 57,802,554 Y151C probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Sptlc1 A G 13: 53,333,957 V450A probably benign Het
Sqle A G 15: 59,315,972 Y43C probably benign Het
Srgap3 T C 6: 112,766,897 H460R probably benign Het
Syt15 A T 14: 34,223,067 E190D possibly damaging Het
Tbc1d10b T C 7: 127,198,821 K716R probably benign Het
Tbx20 T C 9: 24,770,697 I120M probably damaging Het
Tgm1 T G 14: 55,710,521 I274L probably benign Het
Tmem156 C T 5: 65,075,562 probably null Het
Tnk2 A G 16: 32,670,134 D264G possibly damaging Het
Tsc22d4 A G 5: 137,758,694 S306G possibly damaging Het
Tut1 T A 19: 8,959,262 V150D probably benign Het
Uchl5 T C 1: 143,794,537 F143L Het
Vmn1r23 T C 6: 57,926,334 K153R probably benign Het
Zfp236 A T 18: 82,680,673 D94E probably benign Het
Zfp759 T C 13: 67,139,626 Y414H possibly damaging Het
Other mutations in Hivep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Hivep2 APN 10 14142244 missense probably damaging 1.00
IGL00963:Hivep2 APN 10 14129347 missense probably damaging 1.00
IGL01066:Hivep2 APN 10 14149024 missense possibly damaging 0.92
IGL01395:Hivep2 APN 10 14132800 critical splice donor site probably null
IGL01474:Hivep2 APN 10 14143662 missense probably damaging 1.00
IGL01481:Hivep2 APN 10 14149237 missense probably benign
IGL01597:Hivep2 APN 10 14149374 nonsense probably null
IGL01719:Hivep2 APN 10 14130523 missense probably damaging 1.00
IGL01952:Hivep2 APN 10 14142331 missense possibly damaging 0.54
IGL02170:Hivep2 APN 10 14127804 missense possibly damaging 0.46
IGL02315:Hivep2 APN 10 14131239 missense probably benign 0.01
IGL02517:Hivep2 APN 10 14131182 missense probably benign 0.01
IGL02535:Hivep2 APN 10 14139497 missense probably damaging 1.00
IGL02539:Hivep2 APN 10 14131878 missense probably damaging 0.97
IGL02637:Hivep2 APN 10 14130708 missense possibly damaging 0.89
IGL02715:Hivep2 APN 10 14131387 missense probably benign 0.03
IGL02948:Hivep2 APN 10 14129013 missense probably benign 0.44
IGL03113:Hivep2 APN 10 14130651 missense probably damaging 1.00
IGL03161:Hivep2 APN 10 14143356 missense probably damaging 1.00
IGL03173:Hivep2 APN 10 14127982 missense possibly damaging 0.75
IGL03310:Hivep2 APN 10 14143667 missense probably damaging 1.00
R0005:Hivep2 UTSW 10 14128749 missense probably damaging 0.99
R0053:Hivep2 UTSW 10 14132121 missense probably damaging 1.00
R0053:Hivep2 UTSW 10 14132121 missense probably damaging 1.00
R0136:Hivep2 UTSW 10 14131878 missense probably benign 0.04
R0143:Hivep2 UTSW 10 14129355 missense probably damaging 1.00
R0172:Hivep2 UTSW 10 14139474 missense probably damaging 1.00
R0226:Hivep2 UTSW 10 14129712 missense probably benign 0.26
R0348:Hivep2 UTSW 10 14129958 missense possibly damaging 0.76
R0352:Hivep2 UTSW 10 14143295 missense possibly damaging 0.74
R0657:Hivep2 UTSW 10 14131878 missense probably benign 0.04
R1710:Hivep2 UTSW 10 14129505 nonsense probably null
R1959:Hivep2 UTSW 10 14132709 missense probably benign 0.02
R2017:Hivep2 UTSW 10 14130757 missense probably damaging 0.96
R2085:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2085:Hivep2 UTSW 10 14139529 nonsense probably null
R2163:Hivep2 UTSW 10 14128226 nonsense probably null
R2206:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2207:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2228:Hivep2 UTSW 10 14128363 missense probably damaging 1.00
R2241:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2242:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2243:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2246:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2247:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2273:Hivep2 UTSW 10 14132443 missense probably benign 0.02
R2357:Hivep2 UTSW 10 14143299 missense probably benign 0.01
R2517:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2519:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2858:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2859:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2916:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2921:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3051:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3177:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3277:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3620:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3621:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3701:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3802:Hivep2 UTSW 10 14148961 missense possibly damaging 0.94
R3810:Hivep2 UTSW 10 14130357 missense probably benign
R3811:Hivep2 UTSW 10 14130357 missense probably benign
R3817:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3818:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3819:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3836:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3837:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3838:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3839:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3897:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3900:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3932:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3954:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3957:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4001:Hivep2 UTSW 10 14127732 missense probably damaging 1.00
R4134:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4180:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4248:Hivep2 UTSW 10 14131555 missense probably damaging 1.00
R4416:Hivep2 UTSW 10 14129170 missense probably benign
R4436:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4437:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4474:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4475:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4476:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4636:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4637:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4791:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4792:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4825:Hivep2 UTSW 10 14131319 missense possibly damaging 0.81
R4955:Hivep2 UTSW 10 14130958 missense probably benign 0.44
R5094:Hivep2 UTSW 10 14132149 missense probably benign
R5129:Hivep2 UTSW 10 14130864 missense probably damaging 1.00
R5163:Hivep2 UTSW 10 14139425 missense probably damaging 1.00
R5255:Hivep2 UTSW 10 14131267 unclassified probably null
R5330:Hivep2 UTSW 10 14131420 missense probably damaging 1.00
R5341:Hivep2 UTSW 10 14132592 missense possibly damaging 0.94
R5453:Hivep2 UTSW 10 14128228 missense possibly damaging 0.78
R5513:Hivep2 UTSW 10 14132673 nonsense probably null
R5535:Hivep2 UTSW 10 14131022 missense probably benign 0.00
R5613:Hivep2 UTSW 10 14139495 missense probably damaging 1.00
R5804:Hivep2 UTSW 10 14133775 missense probably benign 0.01
R6074:Hivep2 UTSW 10 14131741 missense probably benign 0.18
R6163:Hivep2 UTSW 10 14129992 missense probably damaging 0.98
R6250:Hivep2 UTSW 10 14131759 missense probably benign 0.01
R6696:Hivep2 UTSW 10 14133759 missense probably benign 0.06
R6754:Hivep2 UTSW 10 14129638 missense probably benign 0.06
R6756:Hivep2 UTSW 10 14132559 missense probably damaging 1.00
R6799:Hivep2 UTSW 10 14129013 missense probably benign 0.28
R6862:Hivep2 UTSW 10 14130583 missense probably damaging 1.00
R6932:Hivep2 UTSW 10 14128501 missense probably damaging 1.00
R6943:Hivep2 UTSW 10 14128314 missense probably damaging 1.00
R7027:Hivep2 UTSW 10 14149577 missense probably damaging 0.99
R7027:Hivep2 UTSW 10 14149578 missense probably damaging 1.00
R7198:Hivep2 UTSW 10 14129966 missense probably benign
R7248:Hivep2 UTSW 10 14131165 missense possibly damaging 0.86
R7256:Hivep2 UTSW 10 14129101 missense probably benign 0.29
R7426:Hivep2 UTSW 10 14131317 missense possibly damaging 0.93
R7427:Hivep2 UTSW 10 14133741 missense possibly damaging 0.94
R7638:Hivep2 UTSW 10 14143851 missense possibly damaging 0.81
R7740:Hivep2 UTSW 10 14127670 missense probably damaging 1.00
R7797:Hivep2 UTSW 10 14130103 missense probably benign
Z1177:Hivep2 UTSW 10 14131786 missense probably damaging 1.00
Z1177:Hivep2 UTSW 10 14143307 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCATTAGACACTTTGGCGG -3'
(R):5'- TTTTGGTCAGGCTCAAGATGAC -3'

Sequencing Primer
(F):5'- AGGTCAGCCCTGTACCTCAG -3'
(R):5'- AGGACAGGCATGCTATCA -3'
Posted On2019-11-12