Incidental Mutation 'R0242:Syne2'
ID 59585
Institutional Source Beutler Lab
Gene Symbol Syne2
Ensembl Gene ENSMUSG00000063450
Gene Name spectrin repeat containing, nuclear envelope 2
Synonyms Nesp2g, diminished cone electroretinogram, Cpfl8, dice, 6820443O06Rik, nesprin-2, syne-2, D12Ertd777e
MMRRC Submission 038480-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.313) question?
Stock # R0242 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 75865092-76157702 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 76144808 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 1586 (G1586S)
Ref Sequence ENSEMBL: ENSMUSP00000082383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044217] [ENSMUST00000085280] [ENSMUST00000126903] [ENSMUST00000131480] [ENSMUST00000143031] [ENSMUST00000154509]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044217
AA Change: G6325S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047697
Gene: ENSMUSG00000063450
AA Change: G6325S

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
coiled coil region 844 869 N/A INTRINSIC
coiled coil region 936 969 N/A INTRINSIC
coiled coil region 1006 1032 N/A INTRINSIC
SPEC 1427 1525 4.96e0 SMART
SPEC 1528 1632 2.48e-1 SMART
coiled coil region 1660 1699 N/A INTRINSIC
SPEC 2034 2131 1.83e0 SMART
coiled coil region 2173 2194 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
coiled coil region 2316 2348 N/A INTRINSIC
SPEC 2720 2820 1.44e-5 SMART
coiled coil region 2905 2934 N/A INTRINSIC
coiled coil region 2962 2989 N/A INTRINSIC
coiled coil region 3108 3136 N/A INTRINSIC
low complexity region 3333 3350 N/A INTRINSIC
low complexity region 3514 3523 N/A INTRINSIC
low complexity region 3666 3676 N/A INTRINSIC
coiled coil region 3678 3708 N/A INTRINSIC
coiled coil region 3761 3788 N/A INTRINSIC
coiled coil region 3846 3903 N/A INTRINSIC
coiled coil region 4015 4067 N/A INTRINSIC
low complexity region 4102 4115 N/A INTRINSIC
coiled coil region 4483 4511 N/A INTRINSIC
low complexity region 4557 4569 N/A INTRINSIC
coiled coil region 4655 4688 N/A INTRINSIC
low complexity region 4749 4763 N/A INTRINSIC
SPEC 4827 4926 5.25e-1 SMART
SPEC 4933 5038 2.64e-4 SMART
SPEC 5048 5152 1.47e-2 SMART
SPEC 5159 5259 4.29e0 SMART
SPEC 5263 5371 4.47e0 SMART
low complexity region 5373 5393 N/A INTRINSIC
SPEC 5583 5681 5.7e-1 SMART
Blast:SPEC 5690 5793 2e-53 BLAST
SPEC 5800 5900 2.11e0 SMART
SPEC 5907 6005 6.91e-8 SMART
SPEC 6012 6119 4.45e-11 SMART
SPEC 6126 6228 6.39e-12 SMART
SPEC 6235 6335 7.75e-11 SMART
SPEC 6539 6642 5.53e-7 SMART
SPEC 6649 6753 5.12e-2 SMART
KASH 6817 6874 8.17e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085280
AA Change: G1586S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082383
Gene: ENSMUSG00000063450
AA Change: G1586S

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
SPEC 88 187 5.25e-1 SMART
SPEC 194 299 2.64e-4 SMART
SPEC 309 413 1.47e-2 SMART
SPEC 420 520 4.29e0 SMART
SPEC 524 632 4.47e0 SMART
low complexity region 634 654 N/A INTRINSIC
SPEC 844 942 5.7e-1 SMART
Blast:SPEC 951 1054 2e-53 BLAST
SPEC 1061 1161 2.11e0 SMART
SPEC 1168 1266 6.91e-8 SMART
SPEC 1273 1380 4.45e-11 SMART
SPEC 1387 1489 6.39e-12 SMART
SPEC 1496 1596 7.75e-11 SMART
SPEC 1823 1926 5.53e-7 SMART
SPEC 1933 2037 5.12e-2 SMART
KASH 2095 2152 8.17e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126903
SMART Domains Protein: ENSMUSP00000115053
Gene: ENSMUSG00000063450

DomainStartEndE-ValueType
Blast:SPEC 19 62 5e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131480
SMART Domains Protein: ENSMUSP00000114364
Gene: ENSMUSG00000063450

DomainStartEndE-ValueType
Blast:SPEC 1 63 3e-33 BLAST
SPEC 70 168 6.91e-8 SMART
SPEC 175 269 3.46e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132161
AA Change: G322S
SMART Domains Protein: ENSMUSP00000122781
Gene: ENSMUSG00000063450
AA Change: G322S

DomainStartEndE-ValueType
SPEC 10 117 4.45e-11 SMART
SPEC 124 226 6.39e-12 SMART
SPEC 233 333 7.75e-11 SMART
SPEC 560 663 5.53e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000139204
AA Change: G1100S
SMART Domains Protein: ENSMUSP00000118921
Gene: ENSMUSG00000063450
AA Change: G1100S

DomainStartEndE-ValueType
SPEC 39 147 4.47e0 SMART
low complexity region 149 169 N/A INTRINSIC
SPEC 359 457 5.7e-1 SMART
Blast:SPEC 466 569 3e-53 BLAST
SPEC 576 676 2.11e0 SMART
SPEC 683 781 6.91e-8 SMART
SPEC 788 895 4.45e-11 SMART
SPEC 902 1004 6.39e-12 SMART
SPEC 1011 1111 7.75e-11 SMART
SPEC 1315 1418 5.53e-7 SMART
SPEC 1425 1529 5.12e-2 SMART
KASH 1587 1644 8.17e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143031
AA Change: G6326S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119120
Gene: ENSMUSG00000063450
AA Change: G6326S

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
coiled coil region 845 870 N/A INTRINSIC
coiled coil region 937 970 N/A INTRINSIC
coiled coil region 1007 1033 N/A INTRINSIC
SPEC 1428 1526 4.96e0 SMART
SPEC 1529 1633 2.48e-1 SMART
coiled coil region 1661 1700 N/A INTRINSIC
SPEC 2035 2132 1.83e0 SMART
coiled coil region 2174 2195 N/A INTRINSIC
low complexity region 2296 2308 N/A INTRINSIC
coiled coil region 2317 2349 N/A INTRINSIC
SPEC 2721 2821 1.44e-5 SMART
coiled coil region 2906 2935 N/A INTRINSIC
coiled coil region 2963 2990 N/A INTRINSIC
coiled coil region 3109 3137 N/A INTRINSIC
low complexity region 3334 3351 N/A INTRINSIC
low complexity region 3515 3524 N/A INTRINSIC
low complexity region 3667 3677 N/A INTRINSIC
coiled coil region 3679 3709 N/A INTRINSIC
coiled coil region 3762 3789 N/A INTRINSIC
coiled coil region 3847 3904 N/A INTRINSIC
coiled coil region 4016 4068 N/A INTRINSIC
low complexity region 4103 4116 N/A INTRINSIC
coiled coil region 4484 4512 N/A INTRINSIC
low complexity region 4558 4570 N/A INTRINSIC
coiled coil region 4656 4689 N/A INTRINSIC
low complexity region 4750 4764 N/A INTRINSIC
SPEC 4828 4927 5.25e-1 SMART
SPEC 4934 5039 2.64e-4 SMART
SPEC 5049 5153 1.47e-2 SMART
SPEC 5160 5260 4.29e0 SMART
SPEC 5264 5372 4.47e0 SMART
low complexity region 5374 5394 N/A INTRINSIC
SPEC 5584 5682 5.7e-1 SMART
Blast:SPEC 5691 5794 2e-53 BLAST
SPEC 5801 5901 2.11e0 SMART
SPEC 5908 6006 6.91e-8 SMART
SPEC 6013 6120 4.45e-11 SMART
SPEC 6127 6229 6.39e-12 SMART
SPEC 6236 6336 7.75e-11 SMART
SPEC 6540 6643 5.53e-7 SMART
SPEC 6650 6754 5.12e-2 SMART
KASH 6813 6870 8.17e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151286
Predicted Effect probably benign
Transcript: ENSMUST00000154509
SMART Domains Protein: ENSMUSP00000116718
Gene: ENSMUSG00000063450

DomainStartEndE-ValueType
SPEC 19 125 3.13e-6 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for one knock-out allele show normal myonuclear positioning of both synaptic and non-synaptic nuclei in skeletal muscle cells. Homozygotes for another knock-out allele exhibit a thickened epidermis and altered nuclear envelope architecture inprimary dermal fibroblasts and keratinocytes. Mice homozygous for a spontaneous mutation exhibit early retinal defects in photoreceptors, secondary Neurons, and muller glia. [provided by MGI curators]
Allele List at MGI

 All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,601,676 (GRCm39) D230G probably benign Het
Abhd13 A G 8: 10,037,561 (GRCm39) I53V probably benign Het
Adgrl2 A C 3: 148,544,821 (GRCm39) probably null Het
Aldh16a1 G A 7: 44,794,088 (GRCm39) A596V probably damaging Het
Aldh3b2 T A 19: 4,029,414 (GRCm39) Y262* probably null Het
Ambn A G 5: 88,615,831 (GRCm39) Q420R possibly damaging Het
Ankib1 A C 5: 3,750,344 (GRCm39) probably benign Het
Arhgap9 C A 10: 127,165,407 (GRCm39) H430Q probably benign Het
Arhgef25 C T 10: 127,019,933 (GRCm39) G435E probably damaging Het
Armc12 A T 17: 28,751,366 (GRCm39) D120V possibly damaging Het
Asxl3 G A 18: 22,649,738 (GRCm39) E576K possibly damaging Het
Bcdin3d T C 15: 99,368,776 (GRCm39) E141G probably benign Het
Bmpr1b G A 3: 141,546,437 (GRCm39) T483M probably damaging Het
Caprin2 C T 6: 148,744,452 (GRCm39) S991N probably damaging Het
Cd96 T C 16: 45,892,129 (GRCm39) I286M possibly damaging Het
Cdcp1 G T 9: 123,009,237 (GRCm39) F480L probably benign Het
Celf5 T C 10: 81,300,243 (GRCm39) T258A probably benign Het
Cgnl1 A G 9: 71,628,939 (GRCm39) V577A probably damaging Het
Clca3b A G 3: 144,547,226 (GRCm39) S304P probably benign Het
Cmya5 A T 13: 93,232,108 (GRCm39) H993Q probably benign Het
Cnbp A T 6: 87,822,746 (GRCm39) C6S probably damaging Het
Col14a1 C T 15: 55,360,907 (GRCm39) R1605W probably damaging Het
Cops7a T C 6: 124,941,817 (GRCm39) N11S probably benign Het
Coro7 T C 16: 4,448,042 (GRCm39) probably benign Het
Cpvl T C 6: 53,909,485 (GRCm39) H217R possibly damaging Het
Cuedc1 T C 11: 88,075,447 (GRCm39) probably benign Het
Cyp2c66 A G 19: 39,130,369 (GRCm39) Y68C probably damaging Het
Dicer1 G A 12: 104,668,710 (GRCm39) T1324M probably benign Het
Dlgap2 A G 8: 14,777,562 (GRCm39) D268G probably benign Het
Dnm1 T A 2: 32,207,001 (GRCm39) M535L possibly damaging Het
Dock7 A T 4: 98,850,517 (GRCm39) F1575Y probably benign Het
Dpp10 T A 1: 123,326,275 (GRCm39) H403L possibly damaging Het
Dync1h1 A G 12: 110,616,285 (GRCm39) D3112G possibly damaging Het
Eno3 A G 11: 70,548,761 (GRCm39) E21G probably null Het
Fam120b T A 17: 15,643,186 (GRCm39) V655D probably damaging Het
Fkbp5 A T 17: 28,647,426 (GRCm39) D136E probably benign Het
Gdap1l1 T A 2: 163,289,573 (GRCm39) Y179* probably null Het
Gfer A G 17: 24,913,277 (GRCm39) W192R probably damaging Het
Gm4782 A G 6: 50,586,838 (GRCm39) T408A probably benign Het
Golgb1 C T 16: 36,695,992 (GRCm39) Q164* probably null Het
Gpnmb A G 6: 49,024,276 (GRCm39) N197S probably damaging Het
Gtf2f1 G A 17: 57,310,802 (GRCm39) T414M probably benign Het
Hc A G 2: 34,926,166 (GRCm39) probably benign Het
Hcfc1 A T X: 72,992,035 (GRCm39) probably benign Het
Helz2 C T 2: 180,872,223 (GRCm39) R2539Q probably damaging Het
Hsd17b12 T A 2: 93,988,160 (GRCm39) I19F probably benign Het
Incenp T C 19: 9,871,114 (GRCm39) T172A unknown Het
Jmy A G 13: 93,578,126 (GRCm39) Y681H probably benign Het
Kbtbd11 A G 8: 15,077,508 (GRCm39) T36A probably benign Het
Kcnh4 T C 11: 100,646,525 (GRCm39) D267G probably damaging Het
Krt34 C T 11: 99,932,157 (GRCm39) E56K probably damaging Het
Krt40 T A 11: 99,429,568 (GRCm39) E335D probably damaging Het
Krt86 T A 15: 101,374,454 (GRCm39) Y282* probably null Het
Lgi3 C T 14: 70,772,255 (GRCm39) R267* probably null Het
Lnpk A G 2: 74,367,633 (GRCm39) probably benign Het
Lrp1b T A 2: 40,888,195 (GRCm39) H2355L probably benign Het
Lrrc8e G A 8: 4,285,401 (GRCm39) R542H probably benign Het
Mia2 T C 12: 59,155,642 (GRCm39) Y452H probably damaging Het
Mmachc C T 4: 116,561,738 (GRCm39) R132Q probably damaging Het
Mtbp T A 15: 55,440,882 (GRCm39) N356K possibly damaging Het
Myo5b A G 18: 74,794,787 (GRCm39) H552R possibly damaging Het
Niban1 A G 1: 151,593,967 (GRCm39) D884G probably benign Het
Noxred1 A G 12: 87,273,753 (GRCm39) V96A probably benign Het
Nr1d2 T A 14: 18,211,933 (GRCm38) D390V possibly damaging Het
Oas1e A T 5: 120,929,839 (GRCm39) probably benign Het
Odad2 A T 18: 7,211,516 (GRCm39) V786D probably damaging Het
Or1r1 T C 11: 73,874,538 (GRCm39) S299G probably benign Het
Or6c1b T A 10: 129,273,217 (GRCm39) Y179N probably damaging Het
Otog G T 7: 45,916,805 (GRCm39) C914F probably damaging Het
Pank2 G T 2: 131,122,117 (GRCm39) C214F probably damaging Het
Pcdhb1 T A 18: 37,399,788 (GRCm39) S580T probably benign Het
Pdia3 T C 2: 121,244,592 (GRCm39) S2P probably damaging Het
Peli1 G T 11: 21,092,602 (GRCm39) R83L probably damaging Het
Pla2g3 T A 11: 3,441,935 (GRCm39) C366* probably null Het
Pon3 T A 6: 5,240,860 (GRCm39) D107V probably benign Het
Ppip5k2 A G 1: 97,668,816 (GRCm39) C532R probably damaging Het
Prph A T 15: 98,953,608 (GRCm39) D174V probably damaging Het
Psd3 A G 8: 68,210,738 (GRCm39) M270T probably damaging Het
Pum3 A G 19: 27,400,155 (GRCm39) probably benign Het
Pus1 A T 5: 110,927,664 (GRCm39) H30Q probably benign Het
Pwwp3a T C 10: 80,070,092 (GRCm39) S354P probably benign Het
Rab7 A T 6: 87,982,114 (GRCm39) V87E probably damaging Het
Rbm5 A T 9: 107,628,907 (GRCm39) probably benign Het
Reln A G 5: 22,147,595 (GRCm39) probably null Het
S1pr3 A G 13: 51,572,938 (GRCm39) T40A probably benign Het
Sdk1 T A 5: 142,129,677 (GRCm39) probably benign Het
Senp7 T A 16: 55,999,884 (GRCm39) I853N probably damaging Het
Serpinb6c T A 13: 34,083,230 (GRCm39) probably benign Het
Shroom1 T G 11: 53,356,312 (GRCm39) probably null Het
Slc24a3 T C 2: 145,448,584 (GRCm39) I376T probably benign Het
Slc46a1 T C 11: 78,359,493 (GRCm39) I375T possibly damaging Het
Slc4a9 T C 18: 36,666,733 (GRCm39) F527S probably damaging Het
Slc4a9 T A 18: 36,674,286 (GRCm39) I924N probably damaging Het
Slx4 T A 16: 3,804,816 (GRCm39) E666V probably damaging Het
Snrnp27 G A 6: 86,652,575 (GRCm39) probably benign Het
Sorcs1 C T 19: 50,216,659 (GRCm39) G640E probably damaging Het
Spmap2l G T 5: 77,164,152 (GRCm39) E52* probably null Het
Sptan1 A T 2: 29,908,413 (GRCm39) M1725L probably benign Het
Sync G A 4: 129,187,514 (GRCm39) R182K probably damaging Het
Sytl1 G T 4: 132,980,768 (GRCm39) T522K probably damaging Het
Tex2 T A 11: 106,410,781 (GRCm39) K414* probably null Het
Tex55 C T 16: 38,644,929 (GRCm39) probably benign Het
Thsd7a G A 6: 12,503,915 (GRCm39) T413I probably benign Het
Tm9sf1 C T 14: 55,875,392 (GRCm39) A451T possibly damaging Het
Ttn A T 2: 76,656,496 (GRCm39) probably benign Het
Uba2 T C 7: 33,854,054 (GRCm39) I140V possibly damaging Het
Ushbp1 C A 8: 71,842,762 (GRCm39) G361* probably null Het
Wbp2nl C T 15: 82,197,988 (GRCm39) A175V probably benign Het
Zc3h12d A G 10: 7,738,330 (GRCm39) E212G probably damaging Het
Zc3h7b T C 15: 81,653,031 (GRCm39) probably benign Het
Other mutations in Syne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Syne2 APN 12 76,078,474 (GRCm39) unclassified probably benign
IGL00595:Syne2 APN 12 75,972,420 (GRCm39) missense possibly damaging 0.76
IGL00672:Syne2 APN 12 76,110,958 (GRCm39) missense probably damaging 1.00
IGL00781:Syne2 APN 12 76,070,836 (GRCm39) missense probably benign 0.00
IGL00823:Syne2 APN 12 76,036,016 (GRCm39) missense probably damaging 0.98
IGL01014:Syne2 APN 12 75,952,051 (GRCm39) missense probably damaging 0.99
IGL01074:Syne2 APN 12 76,078,361 (GRCm39) nonsense probably null
IGL01074:Syne2 APN 12 76,033,785 (GRCm39) missense probably benign 0.00
IGL01324:Syne2 APN 12 76,090,526 (GRCm39) missense probably damaging 1.00
IGL01325:Syne2 APN 12 75,973,288 (GRCm39) missense probably benign 0.01
IGL01331:Syne2 APN 12 75,976,027 (GRCm39) splice site probably benign
IGL01338:Syne2 APN 12 76,107,000 (GRCm39) missense possibly damaging 0.55
IGL01373:Syne2 APN 12 76,033,881 (GRCm39) missense probably damaging 1.00
IGL01446:Syne2 APN 12 76,088,149 (GRCm39) missense probably damaging 1.00
IGL01556:Syne2 APN 12 76,134,589 (GRCm39) missense probably damaging 1.00
IGL01585:Syne2 APN 12 75,995,834 (GRCm39) critical splice acceptor site probably null
IGL01629:Syne2 APN 12 76,051,377 (GRCm39) missense possibly damaging 0.49
IGL01686:Syne2 APN 12 75,956,110 (GRCm39) missense probably benign
IGL01935:Syne2 APN 12 75,972,087 (GRCm39) missense probably damaging 1.00
IGL01941:Syne2 APN 12 76,013,994 (GRCm39) missense probably benign 0.01
IGL01956:Syne2 APN 12 76,144,748 (GRCm39) missense probably damaging 1.00
IGL01967:Syne2 APN 12 75,988,077 (GRCm39) missense probably damaging 1.00
IGL01990:Syne2 APN 12 76,101,707 (GRCm39) missense probably damaging 1.00
IGL02000:Syne2 APN 12 76,062,419 (GRCm39) missense probably damaging 0.99
IGL02063:Syne2 APN 12 76,098,874 (GRCm39) missense probably damaging 0.96
IGL02069:Syne2 APN 12 75,974,186 (GRCm39) missense probably benign 0.13
IGL02120:Syne2 APN 12 75,993,480 (GRCm39) missense probably damaging 1.00
IGL02222:Syne2 APN 12 75,999,617 (GRCm39) missense probably damaging 0.96
IGL02223:Syne2 APN 12 76,155,079 (GRCm39) missense probably benign 0.00
IGL02321:Syne2 APN 12 75,965,773 (GRCm39) missense possibly damaging 0.58
IGL02488:Syne2 APN 12 76,012,512 (GRCm39) missense probably benign 0.24
IGL02491:Syne2 APN 12 76,118,953 (GRCm39) missense probably benign 0.10
IGL02525:Syne2 APN 12 76,147,777 (GRCm39) missense probably damaging 0.99
IGL02578:Syne2 APN 12 76,069,053 (GRCm39) missense possibly damaging 0.76
IGL02615:Syne2 APN 12 76,143,768 (GRCm39) missense probably damaging 1.00
IGL02702:Syne2 APN 12 76,144,698 (GRCm39) missense probably damaging 1.00
IGL02726:Syne2 APN 12 76,062,356 (GRCm39) missense probably damaging 0.99
IGL02795:Syne2 APN 12 76,013,323 (GRCm39) missense probably damaging 0.99
IGL02803:Syne2 APN 12 76,078,320 (GRCm39) missense probably damaging 1.00
IGL02814:Syne2 APN 12 75,992,150 (GRCm39) missense possibly damaging 0.64
IGL03013:Syne2 APN 12 75,976,111 (GRCm39) missense probably benign 0.00
IGL03131:Syne2 APN 12 76,104,264 (GRCm39) missense probably damaging 1.00
IGL03152:Syne2 APN 12 76,012,486 (GRCm39) missense probably benign 0.12
IGL03216:Syne2 APN 12 75,989,735 (GRCm39) splice site probably benign
IGL03228:Syne2 APN 12 76,026,686 (GRCm39) missense probably benign 0.01
IGL03259:Syne2 APN 12 76,035,853 (GRCm39) missense probably benign 0.05
IGL03374:Syne2 APN 12 76,121,360 (GRCm39) missense possibly damaging 0.66
IGL03375:Syne2 APN 12 75,972,209 (GRCm39) missense possibly damaging 0.57
3-1:Syne2 UTSW 12 75,977,406 (GRCm39) missense probably benign 0.02
B5639:Syne2 UTSW 12 75,976,564 (GRCm39) missense probably benign
K3955:Syne2 UTSW 12 75,977,439 (GRCm39) missense probably damaging 1.00
P0026:Syne2 UTSW 12 75,926,994 (GRCm39) splice site probably benign
PIT4514001:Syne2 UTSW 12 76,151,789 (GRCm39) missense probably damaging 0.99
R0089:Syne2 UTSW 12 76,010,650 (GRCm39) missense probably damaging 1.00
R0110:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0113:Syne2 UTSW 12 76,080,496 (GRCm39) missense probably damaging 1.00
R0113:Syne2 UTSW 12 75,977,352 (GRCm39) missense probably damaging 1.00
R0141:Syne2 UTSW 12 75,988,072 (GRCm39) missense probably damaging 1.00
R0211:Syne2 UTSW 12 76,144,731 (GRCm39) missense probably damaging 1.00
R0219:Syne2 UTSW 12 76,088,778 (GRCm39) missense probably damaging 1.00
R0242:Syne2 UTSW 12 76,144,808 (GRCm39) missense probably damaging 1.00
R0279:Syne2 UTSW 12 76,142,387 (GRCm39) missense probably damaging 1.00
R0319:Syne2 UTSW 12 76,110,936 (GRCm39) missense probably damaging 0.99
R0325:Syne2 UTSW 12 76,009,415 (GRCm39) missense probably benign 0.00
R0329:Syne2 UTSW 12 76,013,727 (GRCm39) missense probably benign
R0330:Syne2 UTSW 12 76,013,727 (GRCm39) missense probably benign
R0361:Syne2 UTSW 12 75,965,384 (GRCm39) missense probably benign 0.22
R0363:Syne2 UTSW 12 76,118,981 (GRCm39) missense probably damaging 0.98
R0367:Syne2 UTSW 12 75,926,951 (GRCm39) missense probably damaging 1.00
R0371:Syne2 UTSW 12 75,980,619 (GRCm39) missense probably damaging 1.00
R0374:Syne2 UTSW 12 75,968,000 (GRCm39) nonsense probably null
R0388:Syne2 UTSW 12 76,033,749 (GRCm39) missense probably benign 0.41
R0411:Syne2 UTSW 12 76,106,358 (GRCm39) splice site probably null
R0432:Syne2 UTSW 12 75,995,838 (GRCm39) missense probably damaging 0.99
R0469:Syne2 UTSW 12 75,900,923 (GRCm39) critical splice donor site probably null
R0492:Syne2 UTSW 12 76,028,837 (GRCm39) critical splice donor site probably null
R0496:Syne2 UTSW 12 76,085,714 (GRCm39) missense possibly damaging 0.80
R0504:Syne2 UTSW 12 76,080,365 (GRCm39) splice site probably benign
R0505:Syne2 UTSW 12 76,146,238 (GRCm39) missense probably damaging 1.00
R0510:Syne2 UTSW 12 75,900,923 (GRCm39) critical splice donor site probably null
R0518:Syne2 UTSW 12 76,155,636 (GRCm39) critical splice acceptor site probably null
R0539:Syne2 UTSW 12 76,070,895 (GRCm39) missense possibly damaging 0.69
R0552:Syne2 UTSW 12 75,977,778 (GRCm39) missense probably benign 0.00
R0557:Syne2 UTSW 12 75,976,075 (GRCm39) missense probably benign 0.04
R0567:Syne2 UTSW 12 75,937,004 (GRCm39) missense probably damaging 0.98
R0599:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0602:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0608:Syne2 UTSW 12 76,010,587 (GRCm39) missense probably damaging 1.00
R0614:Syne2 UTSW 12 75,959,127 (GRCm39) splice site probably null
R0636:Syne2 UTSW 12 75,977,757 (GRCm39) missense possibly damaging 0.75
R0647:Syne2 UTSW 12 75,934,977 (GRCm39) missense probably benign
R0654:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0658:Syne2 UTSW 12 76,141,110 (GRCm39) missense probably damaging 1.00
R0666:Syne2 UTSW 12 75,969,787 (GRCm39) missense probably damaging 0.99
R0707:Syne2 UTSW 12 76,028,837 (GRCm39) critical splice donor site probably null
R0714:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0841:Syne2 UTSW 12 76,121,209 (GRCm39) splice site probably benign
R0848:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0848:Syne2 UTSW 12 76,144,733 (GRCm39) frame shift probably null
R1077:Syne2 UTSW 12 76,088,809 (GRCm39) missense possibly damaging 0.94
R1103:Syne2 UTSW 12 76,156,609 (GRCm39) missense probably benign 0.00
R1144:Syne2 UTSW 12 76,013,298 (GRCm39) missense probably benign 0.04
R1194:Syne2 UTSW 12 75,981,287 (GRCm39) missense probably damaging 1.00
R1247:Syne2 UTSW 12 76,014,264 (GRCm39) missense probably benign 0.39
R1276:Syne2 UTSW 12 75,987,963 (GRCm39) critical splice acceptor site probably null
R1343:Syne2 UTSW 12 76,080,417 (GRCm39) missense probably damaging 1.00
R1442:Syne2 UTSW 12 75,993,489 (GRCm39) missense probably damaging 1.00
R1448:Syne2 UTSW 12 76,098,952 (GRCm39) missense possibly damaging 0.56
R1448:Syne2 UTSW 12 76,067,099 (GRCm39) splice site probably null
R1522:Syne2 UTSW 12 76,150,557 (GRCm39) missense probably damaging 0.98
R1528:Syne2 UTSW 12 76,012,874 (GRCm39) missense probably benign 0.00
R1636:Syne2 UTSW 12 76,051,506 (GRCm39) missense probably benign 0.01
R1637:Syne2 UTSW 12 76,042,776 (GRCm39) missense probably damaging 1.00
R1650:Syne2 UTSW 12 75,951,033 (GRCm39) nonsense probably null
R1654:Syne2 UTSW 12 76,147,868 (GRCm39) missense possibly damaging 0.56
R1714:Syne2 UTSW 12 76,101,713 (GRCm39) missense probably benign 0.26
R1750:Syne2 UTSW 12 76,099,579 (GRCm39) missense probably damaging 1.00
R1772:Syne2 UTSW 12 75,985,503 (GRCm39) missense probably benign 0.19
R1797:Syne2 UTSW 12 76,010,557 (GRCm39) missense probably benign 0.00
R1830:Syne2 UTSW 12 76,156,636 (GRCm39) missense probably damaging 1.00
R1837:Syne2 UTSW 12 76,014,434 (GRCm39) missense probably damaging 0.99
R1908:Syne2 UTSW 12 76,141,053 (GRCm39) critical splice acceptor site probably null
R1913:Syne2 UTSW 12 75,946,020 (GRCm39) missense possibly damaging 0.60
R1944:Syne2 UTSW 12 76,121,318 (GRCm39) missense probably damaging 1.00
R1950:Syne2 UTSW 12 75,999,644 (GRCm39) missense probably benign
R1958:Syne2 UTSW 12 76,016,319 (GRCm39) missense probably benign 0.11
R2018:Syne2 UTSW 12 76,121,353 (GRCm39) missense probably damaging 1.00
R2037:Syne2 UTSW 12 76,072,343 (GRCm39) missense probably benign 0.04
R2067:Syne2 UTSW 12 75,935,116 (GRCm39) critical splice donor site probably null
R2073:Syne2 UTSW 12 76,062,353 (GRCm39) missense possibly damaging 0.54
R2099:Syne2 UTSW 12 76,026,747 (GRCm39) missense probably benign 0.06
R2102:Syne2 UTSW 12 76,074,853 (GRCm39) missense probably benign 0.01
R2134:Syne2 UTSW 12 75,999,560 (GRCm39) missense probably damaging 0.99
R2135:Syne2 UTSW 12 75,999,560 (GRCm39) missense probably damaging 0.99
R2157:Syne2 UTSW 12 76,141,230 (GRCm39) missense probably damaging 1.00
R2173:Syne2 UTSW 12 76,147,763 (GRCm39) splice site probably benign
R2248:Syne2 UTSW 12 76,143,678 (GRCm39) missense probably damaging 1.00
R2276:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2277:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2278:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2279:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2483:Syne2 UTSW 12 76,142,311 (GRCm39) missense probably damaging 1.00
R2877:Syne2 UTSW 12 76,047,605 (GRCm39) missense probably benign 0.00
R2884:Syne2 UTSW 12 76,010,533 (GRCm39) missense probably benign 0.00
R3119:Syne2 UTSW 12 75,956,058 (GRCm39) missense probably benign 0.01
R3499:Syne2 UTSW 12 76,101,752 (GRCm39) splice site probably null
R3827:Syne2 UTSW 12 76,033,805 (GRCm39) missense probably benign 0.02
R3847:Syne2 UTSW 12 76,095,396 (GRCm39) missense probably damaging 1.00
R3849:Syne2 UTSW 12 76,092,839 (GRCm39) nonsense probably null
R3850:Syne2 UTSW 12 76,095,396 (GRCm39) missense probably damaging 1.00
R3859:Syne2 UTSW 12 75,976,558 (GRCm39) missense possibly damaging 0.55
R3861:Syne2 UTSW 12 76,013,253 (GRCm39) missense probably damaging 0.98
R4078:Syne2 UTSW 12 76,082,398 (GRCm39) missense probably damaging 1.00
R4116:Syne2 UTSW 12 75,977,853 (GRCm39) missense probably damaging 1.00
R4326:Syne2 UTSW 12 75,999,516 (GRCm39) missense probably damaging 1.00
R4335:Syne2 UTSW 12 76,074,866 (GRCm39) missense probably damaging 1.00
R4410:Syne2 UTSW 12 76,141,167 (GRCm39) missense probably damaging 1.00
R4412:Syne2 UTSW 12 76,152,834 (GRCm39) missense probably benign 0.01
R4444:Syne2 UTSW 12 76,069,804 (GRCm39) missense probably damaging 1.00
R4595:Syne2 UTSW 12 76,013,845 (GRCm39) missense possibly damaging 0.88
R4604:Syne2 UTSW 12 76,014,484 (GRCm39) missense probably damaging 0.99
R4606:Syne2 UTSW 12 76,036,027 (GRCm39) missense probably damaging 1.00
R4651:Syne2 UTSW 12 76,036,013 (GRCm39) missense probably damaging 0.99
R4656:Syne2 UTSW 12 76,078,147 (GRCm39) missense probably damaging 1.00
R4675:Syne2 UTSW 12 75,996,075 (GRCm39) missense probably damaging 1.00
R4790:Syne2 UTSW 12 76,067,165 (GRCm39) missense probably benign 0.19
R4791:Syne2 UTSW 12 75,956,018 (GRCm39) missense possibly damaging 0.96
R4799:Syne2 UTSW 12 75,945,941 (GRCm39) missense probably benign 0.04
R4836:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4880:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4881:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4899:Syne2 UTSW 12 75,900,875 (GRCm39) missense probably benign 0.03
R4934:Syne2 UTSW 12 75,946,046 (GRCm39) missense probably benign 0.14
R4981:Syne2 UTSW 12 75,987,993 (GRCm39) missense probably damaging 0.98
R4996:Syne2 UTSW 12 75,990,724 (GRCm39) missense possibly damaging 0.87
R5056:Syne2 UTSW 12 75,955,905 (GRCm39) unclassified probably benign
R5066:Syne2 UTSW 12 76,013,325 (GRCm39) missense probably benign 0.05
R5095:Syne2 UTSW 12 75,999,600 (GRCm39) missense probably damaging 0.99
R5151:Syne2 UTSW 12 76,090,484 (GRCm39) missense probably benign 0.06
R5193:Syne2 UTSW 12 76,141,194 (GRCm39) missense probably damaging 1.00
R5267:Syne2 UTSW 12 75,985,515 (GRCm39) missense possibly damaging 0.74
R5288:Syne2 UTSW 12 76,146,112 (GRCm39) missense possibly damaging 0.94
R5402:Syne2 UTSW 12 76,106,213 (GRCm39) missense probably damaging 0.98
R5434:Syne2 UTSW 12 76,018,649 (GRCm39) missense probably damaging 1.00
R5441:Syne2 UTSW 12 76,035,917 (GRCm39) missense possibly damaging 0.75
R5488:Syne2 UTSW 12 75,934,946 (GRCm39) missense probably benign 0.13
R5497:Syne2 UTSW 12 75,927,163 (GRCm39) missense probably benign 0.19
R5506:Syne2 UTSW 12 75,985,495 (GRCm39) missense probably benign 0.01
R5509:Syne2 UTSW 12 75,968,018 (GRCm39) missense probably damaging 1.00
R5518:Syne2 UTSW 12 75,991,944 (GRCm39) missense possibly damaging 0.88
R5561:Syne2 UTSW 12 76,141,232 (GRCm39) nonsense probably null
R5581:Syne2 UTSW 12 75,991,859 (GRCm39) missense probably benign 0.01
R5625:Syne2 UTSW 12 76,141,886 (GRCm39) missense probably benign 0.06
R5642:Syne2 UTSW 12 75,965,306 (GRCm39) missense probably damaging 1.00
R5665:Syne2 UTSW 12 76,154,991 (GRCm39) critical splice donor site probably null
R5666:Syne2 UTSW 12 75,997,733 (GRCm39) missense probably benign 0.16
R5670:Syne2 UTSW 12 75,997,733 (GRCm39) missense probably benign 0.16
R5691:Syne2 UTSW 12 76,074,630 (GRCm39) frame shift probably null
R5696:Syne2 UTSW 12 76,040,919 (GRCm39) missense probably benign 0.00
R5720:Syne2 UTSW 12 76,014,441 (GRCm39) missense probably benign 0.03
R5739:Syne2 UTSW 12 76,044,239 (GRCm39) missense possibly damaging 0.53
R5840:Syne2 UTSW 12 75,927,065 (GRCm39) splice site probably null
R5846:Syne2 UTSW 12 76,074,898 (GRCm39) missense probably benign 0.01
R5850:Syne2 UTSW 12 76,144,749 (GRCm39) missense probably damaging 1.00
R5889:Syne2 UTSW 12 76,119,026 (GRCm39) nonsense probably null
R5912:Syne2 UTSW 12 75,955,721 (GRCm39) critical splice donor site probably null
R5931:Syne2 UTSW 12 76,055,639 (GRCm39) missense probably benign 0.37
R5985:Syne2 UTSW 12 76,012,933 (GRCm39) missense probably damaging 0.96
R5988:Syne2 UTSW 12 75,976,191 (GRCm39) critical splice donor site probably null
R5990:Syne2 UTSW 12 76,070,918 (GRCm39) missense probably benign 0.10
R6038:Syne2 UTSW 12 75,925,158 (GRCm39) nonsense probably null
R6038:Syne2 UTSW 12 75,925,158 (GRCm39) nonsense probably null
R6132:Syne2 UTSW 12 75,991,921 (GRCm39) missense probably benign 0.14
R6136:Syne2 UTSW 12 75,952,099 (GRCm39) missense probably benign 0.24
R6229:Syne2 UTSW 12 75,967,994 (GRCm39) missense probably benign 0.00
R6252:Syne2 UTSW 12 76,016,210 (GRCm39) missense probably benign 0.39
R6271:Syne2 UTSW 12 75,937,155 (GRCm39) missense probably damaging 1.00
R6320:Syne2 UTSW 12 76,108,424 (GRCm39) missense probably damaging 0.96
R6339:Syne2 UTSW 12 76,035,927 (GRCm39) missense probably benign 0.34
R6380:Syne2 UTSW 12 76,151,754 (GRCm39) missense probably damaging 0.98
R6394:Syne2 UTSW 12 76,037,269 (GRCm39) missense probably benign 0.09
R6419:Syne2 UTSW 12 76,143,740 (GRCm39) missense probably damaging 1.00
R6426:Syne2 UTSW 12 75,969,857 (GRCm39) missense probably null 0.97
R6434:Syne2 UTSW 12 76,088,230 (GRCm39) missense probably damaging 0.99
R6437:Syne2 UTSW 12 76,037,188 (GRCm39) missense possibly damaging 0.87
R6466:Syne2 UTSW 12 75,990,675 (GRCm39) missense probably damaging 0.97
R6501:Syne2 UTSW 12 76,074,621 (GRCm39) splice site probably null
R6552:Syne2 UTSW 12 75,937,015 (GRCm39) missense possibly damaging 0.89
R6744:Syne2 UTSW 12 76,121,221 (GRCm39) missense probably damaging 1.00
R6810:Syne2 UTSW 12 75,989,659 (GRCm39) missense probably benign 0.00
R6831:Syne2 UTSW 12 76,013,568 (GRCm39) missense probably benign 0.39
R6861:Syne2 UTSW 12 75,956,040 (GRCm39) missense probably damaging 1.00
R6875:Syne2 UTSW 12 76,082,404 (GRCm39) missense probably damaging 0.99
R6892:Syne2 UTSW 12 76,009,302 (GRCm39) missense probably damaging 0.98
R6899:Syne2 UTSW 12 76,142,503 (GRCm39) splice site probably null
R6906:Syne2 UTSW 12 76,042,760 (GRCm39) missense possibly damaging 0.93
R6909:Syne2 UTSW 12 76,110,969 (GRCm39) missense probably benign 0.04
R6925:Syne2 UTSW 12 75,900,906 (GRCm39) missense possibly damaging 0.58
R6949:Syne2 UTSW 12 76,012,771 (GRCm39) missense probably benign 0.00
R6952:Syne2 UTSW 12 75,974,205 (GRCm39) missense possibly damaging 0.76
R6996:Syne2 UTSW 12 76,074,786 (GRCm39) missense probably damaging 0.99
R7080:Syne2 UTSW 12 76,099,501 (GRCm39) missense probably benign 0.00
R7083:Syne2 UTSW 12 75,990,662 (GRCm39) missense probably damaging 1.00
R7090:Syne2 UTSW 12 75,989,125 (GRCm39) missense probably benign
R7144:Syne2 UTSW 12 76,052,152 (GRCm39) missense probably benign 0.03
R7154:Syne2 UTSW 12 76,106,231 (GRCm39) missense possibly damaging 0.63
R7177:Syne2 UTSW 12 76,018,654 (GRCm39) nonsense probably null
R7190:Syne2 UTSW 12 76,113,361 (GRCm39) missense probably benign 0.01
R7206:Syne2 UTSW 12 76,051,531 (GRCm39) missense probably benign 0.02
R7208:Syne2 UTSW 12 76,078,172 (GRCm39) splice site probably null
R7230:Syne2 UTSW 12 75,980,674 (GRCm39) missense probably benign 0.12
R7260:Syne2 UTSW 12 75,991,853 (GRCm39) missense probably damaging 1.00
R7272:Syne2 UTSW 12 76,095,417 (GRCm39) missense probably benign 0.00
R7296:Syne2 UTSW 12 76,149,810 (GRCm39) missense probably benign 0.00
R7322:Syne2 UTSW 12 76,030,798 (GRCm39) missense probably damaging 1.00
R7329:Syne2 UTSW 12 76,013,758 (GRCm39) missense probably benign 0.01
R7332:Syne2 UTSW 12 76,014,529 (GRCm39) critical splice donor site probably null
R7381:Syne2 UTSW 12 75,973,263 (GRCm39) missense probably benign 0.11
R7401:Syne2 UTSW 12 76,014,155 (GRCm39) missense probably damaging 0.98
R7403:Syne2 UTSW 12 75,962,020 (GRCm39) missense not run
R7429:Syne2 UTSW 12 76,087,184 (GRCm39) nonsense probably null
R7429:Syne2 UTSW 12 75,980,770 (GRCm39) missense probably damaging 1.00
R7430:Syne2 UTSW 12 76,087,184 (GRCm39) nonsense probably null
R7430:Syne2 UTSW 12 75,980,770 (GRCm39) missense probably damaging 1.00
R7438:Syne2 UTSW 12 76,062,337 (GRCm39) missense probably benign 0.04
R7447:Syne2 UTSW 12 76,074,853 (GRCm39) missense probably benign 0.01
R7466:Syne2 UTSW 12 76,092,960 (GRCm39) missense possibly damaging 0.92
R7493:Syne2 UTSW 12 76,012,654 (GRCm39) missense probably benign 0.00
R7502:Syne2 UTSW 12 76,141,100 (GRCm39) missense probably damaging 1.00
R7543:Syne2 UTSW 12 75,953,616 (GRCm39) missense possibly damaging 0.93
R7569:Syne2 UTSW 12 75,974,164 (GRCm39) missense probably benign 0.00
R7599:Syne2 UTSW 12 76,013,145 (GRCm39) missense probably benign 0.04
R7618:Syne2 UTSW 12 75,992,108 (GRCm39) missense probably benign 0.01
R7639:Syne2 UTSW 12 75,981,273 (GRCm39) missense probably damaging 1.00
R7698:Syne2 UTSW 12 75,995,838 (GRCm39) missense probably damaging 0.99
R7702:Syne2 UTSW 12 76,037,161 (GRCm39) missense probably benign 0.16
R7737:Syne2 UTSW 12 75,989,622 (GRCm39) missense probably damaging 1.00
R7742:Syne2 UTSW 12 76,106,209 (GRCm39) missense probably benign 0.02
R7753:Syne2 UTSW 12 76,085,697 (GRCm39) missense probably benign 0.43
R7755:Syne2 UTSW 12 76,044,181 (GRCm39) missense probably benign 0.19
R7757:Syne2 UTSW 12 76,108,553 (GRCm39) missense possibly damaging 0.87
R7790:Syne2 UTSW 12 75,975,877 (GRCm39) splice site probably null
R7808:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7809:Syne2 UTSW 12 76,014,230 (GRCm39) missense probably benign 0.00
R7811:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7834:Syne2 UTSW 12 76,014,021 (GRCm39) missense probably benign 0.00
R7853:Syne2 UTSW 12 76,078,278 (GRCm39) missense probably damaging 1.00
R7867:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7896:Syne2 UTSW 12 76,082,397 (GRCm39) missense probably damaging 0.99
R7903:Syne2 UTSW 12 76,110,958 (GRCm39) missense probably damaging 1.00
R7944:Syne2 UTSW 12 75,951,079 (GRCm39) missense probably damaging 0.98
R7945:Syne2 UTSW 12 75,951,079 (GRCm39) missense probably damaging 0.98
R7963:Syne2 UTSW 12 76,067,174 (GRCm39) missense probably benign 0.38
R7996:Syne2 UTSW 12 76,051,441 (GRCm39) missense probably damaging 1.00
R7998:Syne2 UTSW 12 76,134,632 (GRCm39) missense probably damaging 1.00
R8010:Syne2 UTSW 12 75,977,512 (GRCm39) missense probably benign 0.39
R8016:Syne2 UTSW 12 75,989,681 (GRCm39) missense probably benign 0.19
R8140:Syne2 UTSW 12 75,959,127 (GRCm39) missense possibly damaging 0.63
R8141:Syne2 UTSW 12 76,108,442 (GRCm39) missense possibly damaging 0.66
R8206:Syne2 UTSW 12 76,062,365 (GRCm39) missense probably benign 0.03
R8258:Syne2 UTSW 12 75,996,143 (GRCm39) missense possibly damaging 0.95
R8259:Syne2 UTSW 12 75,996,143 (GRCm39) missense possibly damaging 0.95
R8320:Syne2 UTSW 12 76,150,604 (GRCm39) missense probably damaging 0.99
R8464:Syne2 UTSW 12 76,012,546 (GRCm39) missense probably benign 0.39
R8465:Syne2 UTSW 12 75,900,898 (GRCm39) missense possibly damaging 0.92
R8486:Syne2 UTSW 12 76,088,881 (GRCm39) nonsense probably null
R8488:Syne2 UTSW 12 76,012,546 (GRCm39) missense probably benign 0.39
R8511:Syne2 UTSW 12 76,055,647 (GRCm39) missense probably benign 0.03
R8540:Syne2 UTSW 12 76,141,148 (GRCm39) missense probably damaging 1.00
R8711:Syne2 UTSW 12 76,104,258 (GRCm39) missense probably damaging 1.00
R8722:Syne2 UTSW 12 75,972,095 (GRCm39) missense probably benign 0.04
R8827:Syne2 UTSW 12 76,095,357 (GRCm39) missense probably benign 0.00
R8867:Syne2 UTSW 12 75,989,620 (GRCm39) missense probably damaging 1.00
R8878:Syne2 UTSW 12 75,952,067 (GRCm39) missense probably benign
R8924:Syne2 UTSW 12 75,943,444 (GRCm39) missense probably damaging 0.97
R8966:Syne2 UTSW 12 76,146,197 (GRCm39) missense probably damaging 1.00
R9007:Syne2 UTSW 12 76,146,224 (GRCm39) missense possibly damaging 0.82
R9019:Syne2 UTSW 12 75,999,618 (GRCm39) missense possibly damaging 0.93
R9057:Syne2 UTSW 12 75,937,167 (GRCm39) missense probably damaging 1.00
R9067:Syne2 UTSW 12 75,950,994 (GRCm39) missense probably damaging 1.00
R9081:Syne2 UTSW 12 76,016,290 (GRCm39) nonsense probably null
R9091:Syne2 UTSW 12 75,977,834 (GRCm39) missense probably damaging 1.00
R9123:Syne2 UTSW 12 76,040,838 (GRCm39) missense probably damaging 1.00
R9147:Syne2 UTSW 12 75,937,158 (GRCm39) missense probably damaging 1.00
R9148:Syne2 UTSW 12 75,937,158 (GRCm39) missense probably damaging 1.00
R9163:Syne2 UTSW 12 76,009,349 (GRCm39) missense possibly damaging 0.88
R9192:Syne2 UTSW 12 76,156,703 (GRCm39) missense probably damaging 1.00
R9248:Syne2 UTSW 12 76,154,230 (GRCm39) intron probably benign
R9270:Syne2 UTSW 12 75,977,834 (GRCm39) missense probably damaging 1.00
R9292:Syne2 UTSW 12 75,997,823 (GRCm39) missense probably benign
R9397:Syne2 UTSW 12 76,040,849 (GRCm39) missense possibly damaging 0.59
R9454:Syne2 UTSW 12 76,141,844 (GRCm39) nonsense probably null
R9454:Syne2 UTSW 12 76,067,275 (GRCm39) missense probably damaging 0.99
R9478:Syne2 UTSW 12 76,154,387 (GRCm39) missense probably damaging 0.96
R9492:Syne2 UTSW 12 75,995,839 (GRCm39) missense possibly damaging 0.77
R9573:Syne2 UTSW 12 75,927,134 (GRCm39) missense probably damaging 1.00
R9611:Syne2 UTSW 12 76,080,460 (GRCm39) missense probably benign 0.05
R9623:Syne2 UTSW 12 75,986,760 (GRCm39) missense probably benign 0.12
R9647:Syne2 UTSW 12 76,151,875 (GRCm39) missense possibly damaging 0.55
R9652:Syne2 UTSW 12 76,101,620 (GRCm39) missense probably benign 0.00
R9667:Syne2 UTSW 12 75,926,951 (GRCm39) missense probably damaging 1.00
R9701:Syne2 UTSW 12 76,037,197 (GRCm39) missense probably damaging 1.00
R9794:Syne2 UTSW 12 76,047,617 (GRCm39) missense probably benign 0.04
R9802:Syne2 UTSW 12 76,037,197 (GRCm39) missense probably damaging 1.00
X0019:Syne2 UTSW 12 76,020,061 (GRCm39) missense probably benign 0.41
X0026:Syne2 UTSW 12 76,147,790 (GRCm39) missense possibly damaging 0.78
X0061:Syne2 UTSW 12 75,974,285 (GRCm39) critical splice donor site probably null
X0066:Syne2 UTSW 12 76,143,701 (GRCm39) missense probably damaging 1.00
Z1176:Syne2 UTSW 12 76,087,157 (GRCm39) missense possibly damaging 0.48
Z1176:Syne2 UTSW 12 76,014,315 (GRCm39) missense probably benign 0.01
Z1177:Syne2 UTSW 12 76,020,197 (GRCm39) missense probably damaging 1.00
Z1177:Syne2 UTSW 12 76,144,748 (GRCm39) missense probably damaging 1.00
Z1177:Syne2 UTSW 12 76,110,912 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GCTCGTTTTGAGGACAAAGCTCAC -3'
(R):5'- AAGAGAACTGCTTCCCTGGACCAC -3'

Sequencing Primer
(F):5'- TTTGAGGACAAAGCTCACTAAAC -3'
(R):5'- TTCCCTGGACCACAATTGAATG -3'
Posted On 2013-07-11