Incidental Mutation 'R7731:Sptlc1'
ID595860
Institutional Source Beutler Lab
Gene Symbol Sptlc1
Ensembl Gene ENSMUSG00000021468
Gene Nameserine palmitoyltransferase, long chain base subunit 1
SynonymsLcb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7731 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location53332748-53377397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53333957 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 450 (V450A)
Ref Sequence ENSEMBL: ENSMUSP00000021920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021920]
Predicted Effect probably benign
Transcript: ENSMUST00000021920
AA Change: V450A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021920
Gene: ENSMUSG00000021468
AA Change: V450A

DomainStartEndE-ValueType
transmembrane domain 20 40 N/A INTRINSIC
Pfam:Aminotran_1_2 98 464 9.5e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-II pyridoxal-phosphate-dependent aminotransferase family. The encoded protein is the long chain base subunit 1 of serine palmitoyltransferase. Serine palmitoyltransferase converts L-serine and palmitoyl-CoA to 3-oxosphinganine with pyridoxal 5'-phosphate and is the key enzyme in sphingolipid biosynthesis. Mutations in this gene were identified in patients with hereditary sensory neuropathy type 1. Alternatively spliced variants encoding different isoforms have been identified. Pseudogenes of this gene have been defined on chromosomes 1, 6, 10, and 13. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a knock-out allele exhibit abnormal sphingolipid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik C T 16: 13,677,759 R241C probably damaging Het
A430078G23Rik G A 8: 3,384,936 V194M probably damaging Het
A4gnt A G 9: 99,620,417 E210G possibly damaging Het
Accsl T C 2: 93,861,018 T372A probably benign Het
Adgrf5 T A 17: 43,450,560 S1049T probably damaging Het
Agmo G A 12: 37,414,940 R405K probably benign Het
Akap3 A G 6: 126,865,068 T217A probably benign Het
Ankfy1 T A 11: 72,712,281 N45K probably benign Het
Ankrd11 G A 8: 122,895,433 T560I probably benign Het
Aqp1 T C 6: 55,345,819 Y186H possibly damaging Het
Arnt T C 3: 95,483,775 V320A probably benign Het
B230217C12Rik T C 11: 97,841,400 L2P unknown Het
Bco1 C A 8: 117,131,068 S477R possibly damaging Het
Brd4 A G 17: 32,211,224 S703P possibly damaging Het
Ceacam3 T A 7: 17,158,350 N339K Het
Cebpb A G 2: 167,689,206 D62G probably damaging Het
Clca4a T C 3: 144,952,785 I890V probably benign Het
Cyp2d9 A G 15: 82,455,432 probably null Het
Cyth1 T C 11: 118,169,053 T374A possibly damaging Het
Dennd3 A T 15: 73,562,367 H962L probably damaging Het
Dhtkd1 T G 2: 5,924,112 L249F probably benign Het
Dnah7b T A 1: 46,139,745 H859Q probably benign Het
E2f4 A G 8: 105,298,633 D115G probably damaging Het
Exoc3l4 G C 12: 111,430,748 D688H possibly damaging Het
Fan1 C T 7: 64,372,696 V270I probably benign Het
Fat2 A T 11: 55,310,706 I514N probably damaging Het
Fndc1 G A 17: 7,773,439 T475I unknown Het
Fstl5 T A 3: 76,661,762 I574N probably damaging Het
Fzd4 T C 7: 89,408,050 V435A possibly damaging Het
Fzd6 T C 15: 39,033,932 F492S probably damaging Het
Gm4924 T A 10: 82,377,527 N386K unknown Het
Gm8994 A G 6: 136,328,873 I111V probably benign Het
Hbp1 A T 12: 31,933,368 D362E possibly damaging Het
Hectd4 A C 5: 121,307,014 M105L probably benign Het
Hivep2 C T 10: 14,149,714 P2424L probably benign Het
Hspa4 A T 11: 53,266,964 probably null Het
Igf2bp3 A G 6: 49,134,731 V122A probably damaging Het
Ikzf2 A T 1: 69,539,143 N402K possibly damaging Het
Ip6k1 T C 9: 108,044,728 F207S probably damaging Het
Kbtbd8 C A 6: 95,118,578 N24K probably benign Het
Krtap10-4 T G 10: 77,826,820 T75P unknown Het
Macf1 C A 4: 123,444,879 S4355I probably benign Het
Muc5b A T 7: 141,857,305 probably null Het
Myo3a G A 2: 22,282,589 V179M probably damaging Het
Nup210 G T 6: 91,071,888 T462K possibly damaging Het
Olfr1106 T C 2: 87,049,234 M1V probably null Het
Olfr365 A G 2: 37,201,549 M103V probably benign Het
Olfr561 A G 7: 102,774,934 I137V probably benign Het
Olfr743 T A 14: 50,533,684 S91T probably damaging Het
Olfr920 A G 9: 38,756,246 Q186R possibly damaging Het
Ostn G A 16: 27,346,918 R119Q probably damaging Het
Pcdhga11 A T 18: 37,756,511 N191Y probably benign Het
Pcsk6 A T 7: 66,033,893 Q752L probably benign Het
Pfas T C 11: 69,000,045 T347A probably damaging Het
Pkd1 A T 17: 24,573,898 R1520W probably damaging Het
Prpf8 T C 11: 75,508,906 S2264P probably damaging Het
Ptcd1 C A 5: 145,151,364 R612S probably benign Het
Ptch2 T A 4: 117,108,295 F359Y probably benign Het
Ptprr A C 10: 116,237,295 D474A probably damaging Het
Pum1 C A 4: 130,762,963 Q846K probably benign Het
Slc22a14 C T 9: 119,170,611 A505T possibly damaging Het
Smpdl3a A G 10: 57,802,554 Y151C probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Sqle A G 15: 59,315,972 Y43C probably benign Het
Srgap3 T C 6: 112,766,897 H460R probably benign Het
Syt15 A T 14: 34,223,067 E190D possibly damaging Het
Tbc1d10b T C 7: 127,198,821 K716R probably benign Het
Tbx20 T C 9: 24,770,697 I120M probably damaging Het
Tgm1 T G 14: 55,710,521 I274L probably benign Het
Tmem156 C T 5: 65,075,562 probably null Het
Tnk2 A G 16: 32,670,134 D264G possibly damaging Het
Tsc22d4 A G 5: 137,758,694 S306G possibly damaging Het
Tut1 T A 19: 8,959,262 V150D probably benign Het
Uchl5 T C 1: 143,794,537 F143L Het
Vmn1r23 T C 6: 57,926,334 K153R probably benign Het
Zfp236 A T 18: 82,680,673 D94E probably benign Het
Zfp759 T C 13: 67,139,626 Y414H possibly damaging Het
Other mutations in Sptlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Sptlc1 APN 13 53367378 missense probably damaging 0.98
IGL01354:Sptlc1 APN 13 53333951 missense probably benign
IGL01773:Sptlc1 APN 13 53377298 missense probably damaging 0.96
IGL01876:Sptlc1 APN 13 53374012 missense probably benign 0.02
R0390:Sptlc1 UTSW 13 53337612 missense probably benign 0.06
R1371:Sptlc1 UTSW 13 53351624 missense probably benign
R1961:Sptlc1 UTSW 13 53358880 missense probably benign
R2179:Sptlc1 UTSW 13 53351639 missense probably damaging 1.00
R2513:Sptlc1 UTSW 13 53337640 missense possibly damaging 0.61
R4357:Sptlc1 UTSW 13 53374032 missense probably damaging 1.00
R4989:Sptlc1 UTSW 13 53351656 missense probably damaging 0.97
R5055:Sptlc1 UTSW 13 53342182 missense probably benign 0.02
R6415:Sptlc1 UTSW 13 53351692 critical splice acceptor site probably null
R6752:Sptlc1 UTSW 13 53335358 missense possibly damaging 0.67
R7283:Sptlc1 UTSW 13 53344878 missense probably benign 0.03
R7548:Sptlc1 UTSW 13 53367932 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AGGGATATGCTGTCATCTGTCATC -3'
(R):5'- AACCGGTGTGTTAGGCTTGC -3'

Sequencing Primer
(F):5'- ACAACCATCCACTCTGGCTGTG -3'
(R):5'- GCAGGTTGCAAATCCCTCACAG -3'
Posted On2019-11-12