Incidental Mutation 'R7731:Cyp2d9'
ID595868
Institutional Source Beutler Lab
Gene Symbol Cyp2d9
Ensembl Gene ENSMUSG00000068086
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 9
SynonymsCyp2d, testosterone 16alpha-hydroxylase, P450-2D
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7731 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location82433437-82456845 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 82455432 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000086530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089129] [ENSMUST00000229313] [ENSMUST00000229473] [ENSMUST00000229793] [ENSMUST00000230000] [ENSMUST00000230024] [ENSMUST00000230191] [ENSMUST00000231136]
Predicted Effect probably null
Transcript: ENSMUST00000089129
SMART Domains Protein: ENSMUSP00000086530
Gene: ENSMUSG00000068086

DomainStartEndE-ValueType
Pfam:p450 37 497 1.7e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229313
Predicted Effect probably benign
Transcript: ENSMUST00000229473
Predicted Effect probably benign
Transcript: ENSMUST00000229793
Predicted Effect probably benign
Transcript: ENSMUST00000230000
Predicted Effect probably null
Transcript: ENSMUST00000230024
Predicted Effect probably benign
Transcript: ENSMUST00000230191
Predicted Effect probably benign
Transcript: ENSMUST00000231136
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik C T 16: 13,677,759 R241C probably damaging Het
A430078G23Rik G A 8: 3,384,936 V194M probably damaging Het
A4gnt A G 9: 99,620,417 E210G possibly damaging Het
Accsl T C 2: 93,861,018 T372A probably benign Het
Adgrf5 T A 17: 43,450,560 S1049T probably damaging Het
Agmo G A 12: 37,414,940 R405K probably benign Het
Akap3 A G 6: 126,865,068 T217A probably benign Het
Ankfy1 T A 11: 72,712,281 N45K probably benign Het
Ankrd11 G A 8: 122,895,433 T560I probably benign Het
Aqp1 T C 6: 55,345,819 Y186H possibly damaging Het
Arnt T C 3: 95,483,775 V320A probably benign Het
B230217C12Rik T C 11: 97,841,400 L2P unknown Het
Bco1 C A 8: 117,131,068 S477R possibly damaging Het
Brd4 A G 17: 32,211,224 S703P possibly damaging Het
Ceacam3 T A 7: 17,158,350 N339K Het
Cebpb A G 2: 167,689,206 D62G probably damaging Het
Clca4a T C 3: 144,952,785 I890V probably benign Het
Cyth1 T C 11: 118,169,053 T374A possibly damaging Het
Dennd3 A T 15: 73,562,367 H962L probably damaging Het
Dhtkd1 T G 2: 5,924,112 L249F probably benign Het
Dnah7b T A 1: 46,139,745 H859Q probably benign Het
E2f4 A G 8: 105,298,633 D115G probably damaging Het
Exoc3l4 G C 12: 111,430,748 D688H possibly damaging Het
Fan1 C T 7: 64,372,696 V270I probably benign Het
Fat2 A T 11: 55,310,706 I514N probably damaging Het
Fndc1 G A 17: 7,773,439 T475I unknown Het
Fstl5 T A 3: 76,661,762 I574N probably damaging Het
Fzd4 T C 7: 89,408,050 V435A possibly damaging Het
Fzd6 T C 15: 39,033,932 F492S probably damaging Het
Gm4924 T A 10: 82,377,527 N386K unknown Het
Gm8994 A G 6: 136,328,873 I111V probably benign Het
Hbp1 A T 12: 31,933,368 D362E possibly damaging Het
Hectd4 A C 5: 121,307,014 M105L probably benign Het
Hivep2 C T 10: 14,149,714 P2424L probably benign Het
Hspa4 A T 11: 53,266,964 probably null Het
Igf2bp3 A G 6: 49,134,731 V122A probably damaging Het
Ikzf2 A T 1: 69,539,143 N402K possibly damaging Het
Ip6k1 T C 9: 108,044,728 F207S probably damaging Het
Kbtbd8 C A 6: 95,118,578 N24K probably benign Het
Krtap10-4 T G 10: 77,826,820 T75P unknown Het
Macf1 C A 4: 123,444,879 S4355I probably benign Het
Muc5b A T 7: 141,857,305 probably null Het
Myo3a G A 2: 22,282,589 V179M probably damaging Het
Nup210 G T 6: 91,071,888 T462K possibly damaging Het
Olfr1106 T C 2: 87,049,234 M1V probably null Het
Olfr365 A G 2: 37,201,549 M103V probably benign Het
Olfr561 A G 7: 102,774,934 I137V probably benign Het
Olfr743 T A 14: 50,533,684 S91T probably damaging Het
Olfr920 A G 9: 38,756,246 Q186R possibly damaging Het
Ostn G A 16: 27,346,918 R119Q probably damaging Het
Pcdhga11 A T 18: 37,756,511 N191Y probably benign Het
Pcsk6 A T 7: 66,033,893 Q752L probably benign Het
Pfas T C 11: 69,000,045 T347A probably damaging Het
Pkd1 A T 17: 24,573,898 R1520W probably damaging Het
Prpf8 T C 11: 75,508,906 S2264P probably damaging Het
Ptcd1 C A 5: 145,151,364 R612S probably benign Het
Ptch2 T A 4: 117,108,295 F359Y probably benign Het
Ptprr A C 10: 116,237,295 D474A probably damaging Het
Pum1 C A 4: 130,762,963 Q846K probably benign Het
Slc22a14 C T 9: 119,170,611 A505T possibly damaging Het
Smpdl3a A G 10: 57,802,554 Y151C probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Sptlc1 A G 13: 53,333,957 V450A probably benign Het
Sqle A G 15: 59,315,972 Y43C probably benign Het
Srgap3 T C 6: 112,766,897 H460R probably benign Het
Syt15 A T 14: 34,223,067 E190D possibly damaging Het
Tbc1d10b T C 7: 127,198,821 K716R probably benign Het
Tbx20 T C 9: 24,770,697 I120M probably damaging Het
Tgm1 T G 14: 55,710,521 I274L probably benign Het
Tmem156 C T 5: 65,075,562 probably null Het
Tnk2 A G 16: 32,670,134 D264G possibly damaging Het
Tsc22d4 A G 5: 137,758,694 S306G possibly damaging Het
Tut1 T A 19: 8,959,262 V150D probably benign Het
Uchl5 T C 1: 143,794,537 F143L Het
Vmn1r23 T C 6: 57,926,334 K153R probably benign Het
Zfp236 A T 18: 82,680,673 D94E probably benign Het
Zfp759 T C 13: 67,139,626 Y414H possibly damaging Het
Other mutations in Cyp2d9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cyp2d9 APN 15 82455094 missense probably benign 0.05
IGL00587:Cyp2d9 APN 15 82455143 missense possibly damaging 0.89
IGL00815:Cyp2d9 APN 15 82456375 missense possibly damaging 0.94
IGL03023:Cyp2d9 APN 15 82455518 missense probably damaging 0.99
IGL03410:Cyp2d9 APN 15 82456699 missense probably benign 0.00
R0417:Cyp2d9 UTSW 15 82455951 missense probably damaging 1.00
R0627:Cyp2d9 UTSW 15 82455790 missense probably damaging 1.00
R1326:Cyp2d9 UTSW 15 82455156 missense possibly damaging 0.50
R1501:Cyp2d9 UTSW 15 82454324 nonsense probably null
R1893:Cyp2d9 UTSW 15 82452606 missense probably damaging 0.97
R2496:Cyp2d9 UTSW 15 82452479 missense probably damaging 1.00
R2519:Cyp2d9 UTSW 15 82454518 intron probably null
R3155:Cyp2d9 UTSW 15 82452642 critical splice donor site probably null
R4691:Cyp2d9 UTSW 15 82455832 missense probably damaging 1.00
R4727:Cyp2d9 UTSW 15 82454401 start codon destroyed probably null 0.99
R4770:Cyp2d9 UTSW 15 82452573 missense probably damaging 0.98
R5319:Cyp2d9 UTSW 15 82454055 missense probably damaging 1.00
R5486:Cyp2d9 UTSW 15 82452578 missense probably damaging 0.96
R5516:Cyp2d9 UTSW 15 82454327 missense probably null 1.00
R5646:Cyp2d9 UTSW 15 82452464 missense probably benign 0.01
R5898:Cyp2d9 UTSW 15 82455524 missense probably benign 0.02
R6193:Cyp2d9 UTSW 15 82452527 missense probably benign 0.01
R6288:Cyp2d9 UTSW 15 82456415 missense probably damaging 1.00
R6924:Cyp2d9 UTSW 15 82455212 missense probably damaging 1.00
R7524:Cyp2d9 UTSW 15 82455945 missense probably damaging 1.00
R7525:Cyp2d9 UTSW 15 82454092 missense possibly damaging 0.91
R7889:Cyp2d9 UTSW 15 82455826 missense probably damaging 0.97
R7972:Cyp2d9 UTSW 15 82455826 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATTTGCAGTTCTAAGAGATGTAGCC -3'
(R):5'- TAGCACTGGGAGCCACAATC -3'

Sequencing Primer
(F):5'- TTCTAAGAGATGTAGCCAGGAATTG -3'
(R):5'- TCATACCAACTGACTGGGGACTG -3'
Posted On2019-11-12