Incidental Mutation 'R0242:Dicer1'
ID59587
Institutional Source Beutler Lab
Gene Symbol Dicer1
Ensembl Gene ENSMUSG00000041415
Gene Namedicer 1, ribonuclease type III
SynonymsD12Ertd7e
MMRRC Submission 038480-MU
Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0242 (G1)
Quality Score218
Status Validated
Chromosome12
Chromosomal Location104687742-104751952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104702451 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1324 (T1324M)
Ref Sequence ENSEMBL: ENSMUSP00000043676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041987]
Predicted Effect probably benign
Transcript: ENSMUST00000041987
AA Change: T1324M

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: T1324M

DomainStartEndE-ValueType
DEXDc 30 233 5.14e-24 SMART
low complexity region 403 419 N/A INTRINSIC
HELICc 449 546 3.15e-10 SMART
Pfam:Dicer_dimer 620 707 1.4e-25 PFAM
low complexity region 713 723 N/A INTRINSIC
PAZ 881 1056 1.67e-48 SMART
Blast:PAZ 1080 1129 2e-8 BLAST
RIBOc 1285 1582 1.83e-35 SMART
RIBOc 1665 1831 5.97e-49 SMART
DSRM 1834 1897 6.89e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222528
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,676 D230G probably benign Het
4930435E12Rik C T 16: 38,824,567 probably benign Het
Abhd13 A G 8: 9,987,561 I53V probably benign Het
Adgrl2 A C 3: 148,839,185 probably null Het
Aldh16a1 G A 7: 45,144,664 A596V probably damaging Het
Aldh3b2 T A 19: 3,979,414 Y262* probably null Het
Ambn A G 5: 88,467,972 Q420R possibly damaging Het
Ankib1 A C 5: 3,700,344 probably benign Het
Arhgap9 C A 10: 127,329,538 H430Q probably benign Het
Arhgef25 C T 10: 127,184,064 G435E probably damaging Het
Armc12 A T 17: 28,532,392 D120V possibly damaging Het
Armc4 A T 18: 7,211,516 V786D probably damaging Het
Asxl3 G A 18: 22,516,681 E576K possibly damaging Het
Bcdin3d T C 15: 99,470,895 E141G probably benign Het
Bmpr1b G A 3: 141,840,676 T483M probably damaging Het
Caprin2 C T 6: 148,842,954 S991N probably damaging Het
Cd96 T C 16: 46,071,766 I286M possibly damaging Het
Cdcp1 G T 9: 123,180,172 F480L probably benign Het
Celf5 T C 10: 81,464,409 T258A probably benign Het
Cgnl1 A G 9: 71,721,657 V577A probably damaging Het
Clca3b A G 3: 144,841,465 S304P probably benign Het
Cmya5 A T 13: 93,095,600 H993Q probably benign Het
Cnbp A T 6: 87,845,764 C6S probably damaging Het
Col14a1 C T 15: 55,497,511 R1605W probably damaging Het
Cops7a T C 6: 124,964,854 N11S probably benign Het
Coro7 T C 16: 4,630,178 probably benign Het
Cpvl T C 6: 53,932,500 H217R possibly damaging Het
Cuedc1 T C 11: 88,184,621 probably benign Het
Cyp2c66 A G 19: 39,141,925 Y68C probably damaging Het
Dlgap2 A G 8: 14,727,562 D268G probably benign Het
Dnm1 T A 2: 32,316,989 M535L possibly damaging Het
Dock7 A T 4: 98,962,280 F1575Y probably benign Het
Dpp10 T A 1: 123,398,546 H403L possibly damaging Het
Dync1h1 A G 12: 110,649,851 D3112G possibly damaging Het
Eno3 A G 11: 70,657,935 E21G probably null Het
Fam120b T A 17: 15,422,924 V655D probably damaging Het
Fam129a A G 1: 151,718,216 D884G probably benign Het
Fkbp5 A T 17: 28,428,452 D136E probably benign Het
Gdap1l1 T A 2: 163,447,653 Y179* probably null Het
Gfer A G 17: 24,694,303 W192R probably damaging Het
Gm4782 A G 6: 50,609,858 T408A probably benign Het
Golgb1 C T 16: 36,875,630 Q164* probably null Het
Gpnmb A G 6: 49,047,342 N197S probably damaging Het
Gtf2f1 G A 17: 57,003,802 T414M probably benign Het
Hc A G 2: 35,036,154 probably benign Het
Hcfc1 A T X: 73,948,429 probably benign Het
Helz2 C T 2: 181,230,430 R2539Q probably damaging Het
Hsd17b12 T A 2: 94,157,815 I19F probably benign Het
Incenp T C 19: 9,893,750 T172A unknown Het
Jmy A G 13: 93,441,618 Y681H probably benign Het
Kbtbd11 A G 8: 15,027,508 T36A probably benign Het
Kcnh4 T C 11: 100,755,699 D267G probably damaging Het
Krt34 C T 11: 100,041,331 E56K probably damaging Het
Krt40 T A 11: 99,538,742 E335D probably damaging Het
Krt86 T A 15: 101,476,573 Y282* probably null Het
Lgi3 C T 14: 70,534,815 R267* probably null Het
Lnpk A G 2: 74,537,289 probably benign Het
Lrp1b T A 2: 40,998,183 H2355L probably benign Het
Lrrc8e G A 8: 4,235,401 R542H probably benign Het
Mia2 T C 12: 59,108,856 Y452H probably damaging Het
Mmachc C T 4: 116,704,541 R132Q probably damaging Het
Mtbp T A 15: 55,577,486 N356K possibly damaging Het
Mum1 T C 10: 80,234,258 S354P probably benign Het
Myo5b A G 18: 74,661,716 H552R possibly damaging Het
Noxred1 A G 12: 87,226,979 V96A probably benign Het
Nr1d2 T A 14: 18,211,933 D390V possibly damaging Het
Oas1e A T 5: 120,791,774 probably benign Het
Olfr398 T C 11: 73,983,712 S299G probably benign Het
Olfr786 T A 10: 129,437,348 Y179N probably damaging Het
Otog G T 7: 46,267,381 C914F probably damaging Het
Pank2 G T 2: 131,280,197 C214F probably damaging Het
Pcdhb1 T A 18: 37,266,735 S580T probably benign Het
Pdia3 T C 2: 121,414,111 S2P probably damaging Het
Peli1 G T 11: 21,142,602 R83L probably damaging Het
Pla2g3 T A 11: 3,491,935 C366* probably null Het
Pon3 T A 6: 5,240,860 D107V probably benign Het
Ppip5k2 A G 1: 97,741,091 C532R probably damaging Het
Prph A T 15: 99,055,727 D174V probably damaging Het
Psd3 A G 8: 67,758,086 M270T probably damaging Het
Pum3 A G 19: 27,422,755 probably benign Het
Pus1 A T 5: 110,779,798 H30Q probably benign Het
Rab7 A T 6: 88,005,132 V87E probably damaging Het
Rbm5 A T 9: 107,751,708 probably benign Het
Reln A G 5: 21,942,597 probably null Het
S1pr3 A G 13: 51,418,902 T40A probably benign Het
Sdk1 T A 5: 142,143,922 probably benign Het
Senp7 T A 16: 56,179,521 I853N probably damaging Het
Serpinb6c T A 13: 33,899,247 probably benign Het
Shroom1 T G 11: 53,465,485 probably null Het
Slc24a3 T C 2: 145,606,664 I376T probably benign Het
Slc46a1 T C 11: 78,468,667 I375T possibly damaging Het
Slc4a9 T C 18: 36,533,680 F527S probably damaging Het
Slc4a9 T A 18: 36,541,233 I924N probably damaging Het
Slx4 T A 16: 3,986,952 E666V probably damaging Het
Snrnp27 G A 6: 86,675,593 probably benign Het
Sorcs1 C T 19: 50,228,221 G640E probably damaging Het
Sptan1 A T 2: 30,018,401 M1725L probably benign Het
Sync G A 4: 129,293,721 R182K probably damaging Het
Syne2 G A 12: 76,098,034 G1586S probably damaging Het
Sytl1 G T 4: 133,253,457 T522K probably damaging Het
Tex2 T A 11: 106,519,955 K414* probably null Het
Thegl G T 5: 77,016,305 E52* probably null Het
Thsd7a G A 6: 12,503,916 T413I probably benign Het
Tm9sf1 C T 14: 55,637,935 A451T possibly damaging Het
Ttn A T 2: 76,826,152 probably benign Het
Uba2 T C 7: 34,154,629 I140V possibly damaging Het
Ushbp1 C A 8: 71,390,118 G361* probably null Het
Wbp2nl C T 15: 82,313,787 A175V probably benign Het
Zc3h12d A G 10: 7,862,566 E212G probably damaging Het
Zc3h7b T C 15: 81,768,830 probably benign Het
Other mutations in Dicer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dicer1 APN 12 104696772 missense possibly damaging 0.93
IGL01061:Dicer1 APN 12 104706327 missense probably null 0.75
IGL01527:Dicer1 APN 12 104691610 nonsense probably null
IGL01597:Dicer1 APN 12 104705210 nonsense probably null
IGL01636:Dicer1 APN 12 104722241 missense probably damaging 1.00
IGL01717:Dicer1 APN 12 104702787 nonsense probably null
IGL01765:Dicer1 APN 12 104706740 missense probably damaging 1.00
IGL01871:Dicer1 APN 12 104704180 missense probably damaging 1.00
IGL02316:Dicer1 APN 12 104702553 missense probably damaging 1.00
IGL02317:Dicer1 APN 12 104697020 missense probably damaging 1.00
IGL02539:Dicer1 APN 12 104697035 missense probably damaging 0.97
IGL02544:Dicer1 APN 12 104714832 missense probably damaging 1.00
IGL02664:Dicer1 APN 12 104705129 missense probably damaging 1.00
IGL02667:Dicer1 APN 12 104714906 missense probably damaging 1.00
IGL03353:Dicer1 APN 12 104713107 missense probably damaging 1.00
IGL03377:Dicer1 APN 12 104712197 missense probably damaging 0.98
everest UTSW 12 104705128 missense probably damaging 1.00
PIT4480001:Dicer1 UTSW 12 104696544 missense probably benign
R0032:Dicer1 UTSW 12 104704798 nonsense probably null
R0032:Dicer1 UTSW 12 104704798 nonsense probably null
R0219:Dicer1 UTSW 12 104692125 critical splice donor site probably null
R0242:Dicer1 UTSW 12 104702451 missense probably benign 0.02
R0385:Dicer1 UTSW 12 104704174 missense probably damaging 1.00
R0402:Dicer1 UTSW 12 104731064 missense probably benign 0.04
R0426:Dicer1 UTSW 12 104702542 missense probably damaging 1.00
R0453:Dicer1 UTSW 12 104702630 missense probably benign
R0502:Dicer1 UTSW 12 104705060 missense probably damaging 1.00
R0507:Dicer1 UTSW 12 104691658 missense probably damaging 1.00
R0511:Dicer1 UTSW 12 104702841 missense possibly damaging 0.95
R0523:Dicer1 UTSW 12 104702491 missense probably damaging 1.00
R0559:Dicer1 UTSW 12 104706301 missense probably damaging 1.00
R0600:Dicer1 UTSW 12 104706864 missense probably damaging 1.00
R0707:Dicer1 UTSW 12 104706885 missense probably damaging 1.00
R1225:Dicer1 UTSW 12 104691607 missense probably damaging 0.98
R1351:Dicer1 UTSW 12 104729142 missense probably damaging 0.99
R1449:Dicer1 UTSW 12 104729243 missense possibly damaging 0.85
R1575:Dicer1 UTSW 12 104721969 critical splice donor site probably null
R1642:Dicer1 UTSW 12 104713156 missense probably damaging 1.00
R1651:Dicer1 UTSW 12 104708805 missense probably damaging 1.00
R1658:Dicer1 UTSW 12 104700414 missense probably benign
R1815:Dicer1 UTSW 12 104722151 missense probably damaging 1.00
R1816:Dicer1 UTSW 12 104722151 missense probably damaging 1.00
R1927:Dicer1 UTSW 12 104702884 missense possibly damaging 0.91
R2113:Dicer1 UTSW 12 104713214 missense probably damaging 1.00
R2129:Dicer1 UTSW 12 104722031 missense probably damaging 1.00
R2157:Dicer1 UTSW 12 104702949 missense probably benign 0.17
R2202:Dicer1 UTSW 12 104731038 missense probably damaging 0.98
R2203:Dicer1 UTSW 12 104731038 missense probably damaging 0.98
R2243:Dicer1 UTSW 12 104730188 missense probably damaging 0.99
R4237:Dicer1 UTSW 12 104729228 missense possibly damaging 0.48
R4419:Dicer1 UTSW 12 104705114 missense probably damaging 1.00
R4482:Dicer1 UTSW 12 104706277 missense probably damaging 1.00
R4564:Dicer1 UTSW 12 104704751 nonsense probably null
R4776:Dicer1 UTSW 12 104692446 missense probably damaging 0.99
R4834:Dicer1 UTSW 12 104696591 missense probably benign 0.44
R4904:Dicer1 UTSW 12 104713066 missense probably benign
R5202:Dicer1 UTSW 12 104694731 nonsense probably null
R5272:Dicer1 UTSW 12 104704240 missense probably damaging 1.00
R5363:Dicer1 UTSW 12 104703151 missense probably damaging 1.00
R5717:Dicer1 UTSW 12 104705128 missense probably damaging 1.00
R6381:Dicer1 UTSW 12 104696462 missense probably benign 0.00
R6479:Dicer1 UTSW 12 104696723 missense probably damaging 0.97
R6956:Dicer1 UTSW 12 104731023 missense probably damaging 1.00
R7234:Dicer1 UTSW 12 104708849 missense probably damaging 1.00
R7401:Dicer1 UTSW 12 104712278 missense probably benign
R7407:Dicer1 UTSW 12 104722351 nonsense probably null
R7471:Dicer1 UTSW 12 104694710 missense probably damaging 1.00
R7699:Dicer1 UTSW 12 104705170 missense probably damaging 1.00
R7768:Dicer1 UTSW 12 104706697 missense probably damaging 0.99
R7831:Dicer1 UTSW 12 104708800 missense probably damaging 1.00
R7998:Dicer1 UTSW 12 104704069 missense probably damaging 1.00
R8010:Dicer1 UTSW 12 104692132 missense probably damaging 0.99
R8061:Dicer1 UTSW 12 104702818 nonsense probably null
R8213:Dicer1 UTSW 12 104702693 missense probably benign 0.00
R8261:Dicer1 UTSW 12 104691606 missense probably damaging 1.00
R8419:Dicer1 UTSW 12 104702677 missense probably benign 0.00
R8708:Dicer1 UTSW 12 104728445 missense possibly damaging 0.65
R8851:Dicer1 UTSW 12 104724041 missense possibly damaging 0.76
X0018:Dicer1 UTSW 12 104696934 missense probably benign 0.00
Z1176:Dicer1 UTSW 12 104731020 missense probably null 0.97
Predicted Primers PCR Primer
(F):5'- TTCCCAGTAAGAGAAGGTCAGCCC -3'
(R):5'- AGCACTCAAGGACAGGATGGACTC -3'

Sequencing Primer
(F):5'- TCACGTCACTACTGGGCAATG -3'
(R):5'- ATGGACTCTGAGCAGAGCC -3'
Posted On2013-07-11