Incidental Mutation 'R7731:Pkd1'
ID595873
Institutional Source Beutler Lab
Gene Symbol Pkd1
Ensembl Gene ENSMUSG00000032855
Gene Namepolycystin 1, transient receptor poteintial channel interacting
SynonymsPC-1, polycystin-1, PC1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_013630.2; MGI:97603

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7731 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24549834-24596508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24573898 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1520 (R1520W)
Ref Sequence ENSEMBL: ENSMUSP00000049296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000226883] [ENSMUST00000228745]
Predicted Effect probably damaging
Transcript: ENSMUST00000035565
AA Change: R1520W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855
AA Change: R1520W

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226883
Predicted Effect probably benign
Transcript: ENSMUST00000227107
Predicted Effect probably benign
Transcript: ENSMUST00000228745
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype Strain: Several; see below
Lethality: E13-E15
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutant embryos begin to die after embryonic day (E) 14.5. They develop edema by E13.5, pancreatic cysts by E15.5 and kidney cysts by E16.5. Heterozygous adults develop cysts of the kidneys (~20-30%) and the liver (~10%) late in life. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(28) Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik C T 16: 13,677,759 R241C probably damaging Het
A430078G23Rik G A 8: 3,384,936 V194M probably damaging Het
A4gnt A G 9: 99,620,417 E210G possibly damaging Het
Accsl T C 2: 93,861,018 T372A probably benign Het
Adgrf5 T A 17: 43,450,560 S1049T probably damaging Het
Agmo G A 12: 37,414,940 R405K probably benign Het
Akap3 A G 6: 126,865,068 T217A probably benign Het
Ankfy1 T A 11: 72,712,281 N45K probably benign Het
Ankrd11 G A 8: 122,895,433 T560I probably benign Het
Aqp1 T C 6: 55,345,819 Y186H possibly damaging Het
Arnt T C 3: 95,483,775 V320A probably benign Het
B230217C12Rik T C 11: 97,841,400 L2P unknown Het
Bco1 C A 8: 117,131,068 S477R possibly damaging Het
Brd4 A G 17: 32,211,224 S703P possibly damaging Het
Ceacam3 T A 7: 17,158,350 N339K Het
Cebpb A G 2: 167,689,206 D62G probably damaging Het
Clca4a T C 3: 144,952,785 I890V probably benign Het
Cyp2d9 A G 15: 82,455,432 probably null Het
Cyth1 T C 11: 118,169,053 T374A possibly damaging Het
Dennd3 A T 15: 73,562,367 H962L probably damaging Het
Dhtkd1 T G 2: 5,924,112 L249F probably benign Het
Dnah7b T A 1: 46,139,745 H859Q probably benign Het
E2f4 A G 8: 105,298,633 D115G probably damaging Het
Exoc3l4 G C 12: 111,430,748 D688H possibly damaging Het
Fan1 C T 7: 64,372,696 V270I probably benign Het
Fat2 A T 11: 55,310,706 I514N probably damaging Het
Fndc1 G A 17: 7,773,439 T475I unknown Het
Fstl5 T A 3: 76,661,762 I574N probably damaging Het
Fzd4 T C 7: 89,408,050 V435A possibly damaging Het
Fzd6 T C 15: 39,033,932 F492S probably damaging Het
Gm4924 T A 10: 82,377,527 N386K unknown Het
Gm8994 A G 6: 136,328,873 I111V probably benign Het
Hbp1 A T 12: 31,933,368 D362E possibly damaging Het
Hectd4 A C 5: 121,307,014 M105L probably benign Het
Hivep2 C T 10: 14,149,714 P2424L probably benign Het
Hspa4 A T 11: 53,266,964 probably null Het
Igf2bp3 A G 6: 49,134,731 V122A probably damaging Het
Ikzf2 A T 1: 69,539,143 N402K possibly damaging Het
Ip6k1 T C 9: 108,044,728 F207S probably damaging Het
Kbtbd8 C A 6: 95,118,578 N24K probably benign Het
Krtap10-4 T G 10: 77,826,820 T75P unknown Het
Macf1 C A 4: 123,444,879 S4355I probably benign Het
Muc5b A T 7: 141,857,305 probably null Het
Myo3a G A 2: 22,282,589 V179M probably damaging Het
Nup210 G T 6: 91,071,888 T462K possibly damaging Het
Olfr1106 T C 2: 87,049,234 M1V probably null Het
Olfr365 A G 2: 37,201,549 M103V probably benign Het
Olfr561 A G 7: 102,774,934 I137V probably benign Het
Olfr743 T A 14: 50,533,684 S91T probably damaging Het
Olfr920 A G 9: 38,756,246 Q186R possibly damaging Het
Ostn G A 16: 27,346,918 R119Q probably damaging Het
Pcdhga11 A T 18: 37,756,511 N191Y probably benign Het
Pcsk6 A T 7: 66,033,893 Q752L probably benign Het
Pfas T C 11: 69,000,045 T347A probably damaging Het
Prpf8 T C 11: 75,508,906 S2264P probably damaging Het
Ptcd1 C A 5: 145,151,364 R612S probably benign Het
Ptch2 T A 4: 117,108,295 F359Y probably benign Het
Ptprr A C 10: 116,237,295 D474A probably damaging Het
Pum1 C A 4: 130,762,963 Q846K probably benign Het
Slc22a14 C T 9: 119,170,611 A505T possibly damaging Het
Smpdl3a A G 10: 57,802,554 Y151C probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Sptlc1 A G 13: 53,333,957 V450A probably benign Het
Sqle A G 15: 59,315,972 Y43C probably benign Het
Srgap3 T C 6: 112,766,897 H460R probably benign Het
Syt15 A T 14: 34,223,067 E190D possibly damaging Het
Tbc1d10b T C 7: 127,198,821 K716R probably benign Het
Tbx20 T C 9: 24,770,697 I120M probably damaging Het
Tgm1 T G 14: 55,710,521 I274L probably benign Het
Tmem156 C T 5: 65,075,562 probably null Het
Tnk2 A G 16: 32,670,134 D264G possibly damaging Het
Tsc22d4 A G 5: 137,758,694 S306G possibly damaging Het
Tut1 T A 19: 8,959,262 V150D probably benign Het
Uchl5 T C 1: 143,794,537 F143L Het
Vmn1r23 T C 6: 57,926,334 K153R probably benign Het
Zfp236 A T 18: 82,680,673 D94E probably benign Het
Zfp759 T C 13: 67,139,626 Y414H possibly damaging Het
Other mutations in Pkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pkd1 APN 17 24580095 missense probably damaging 1.00
IGL00503:Pkd1 APN 17 24565427 missense probably benign
IGL00549:Pkd1 APN 17 24572761 missense probably benign
IGL00573:Pkd1 APN 17 24594530 nonsense probably null
IGL00924:Pkd1 APN 17 24571627 nonsense probably null
IGL01319:Pkd1 APN 17 24587919 unclassified probably benign
IGL01326:Pkd1 APN 17 24576174 nonsense probably null
IGL01457:Pkd1 APN 17 24594821 splice site probably null
IGL01541:Pkd1 APN 17 24586298 missense probably damaging 1.00
IGL01575:Pkd1 APN 17 24573128 missense probably damaging 1.00
IGL01606:Pkd1 APN 17 24576523 missense probably damaging 0.97
IGL01642:Pkd1 APN 17 24581292 missense probably damaging 1.00
IGL01888:Pkd1 APN 17 24585815 missense possibly damaging 0.91
IGL01940:Pkd1 APN 17 24579746 missense possibly damaging 0.63
IGL01958:Pkd1 APN 17 24580324 missense probably damaging 1.00
IGL02005:Pkd1 APN 17 24586004 missense possibly damaging 0.67
IGL02121:Pkd1 APN 17 24575927 missense probably benign 0.03
IGL02148:Pkd1 APN 17 24579836 missense probably damaging 1.00
IGL02409:Pkd1 APN 17 24573623 missense probably benign 0.01
IGL02442:Pkd1 APN 17 24565226 missense probably benign 0.41
IGL02498:Pkd1 APN 17 24585779 missense possibly damaging 0.91
IGL02501:Pkd1 APN 17 24569699 missense probably benign 0.01
IGL02551:Pkd1 APN 17 24573815 missense probably damaging 1.00
IGL02635:Pkd1 APN 17 24572811 missense probably damaging 1.00
IGL02673:Pkd1 APN 17 24571283 missense probably benign 0.40
IGL02808:Pkd1 APN 17 24593504 missense probably damaging 1.00
IGL02816:Pkd1 APN 17 24594515 missense probably benign 0.00
IGL02863:Pkd1 APN 17 24569752 missense possibly damaging 0.56
IGL02927:Pkd1 APN 17 24575189 missense probably damaging 1.00
IGL02961:Pkd1 APN 17 24578115 missense possibly damaging 0.81
IGL03003:Pkd1 APN 17 24593603 critical splice donor site probably null
IGL03066:Pkd1 APN 17 24586234 missense probably damaging 1.00
IGL03182:Pkd1 APN 17 24573818 missense probably damaging 0.98
IGL03384:Pkd1 APN 17 24565897 missense probably benign 0.00
IGL03404:Pkd1 APN 17 24564406 missense probably damaging 0.97
PIT1430001:Pkd1 UTSW 17 24569511 missense probably damaging 0.99
PIT4494001:Pkd1 UTSW 17 24577801 missense probably damaging 1.00
PIT4677001:Pkd1 UTSW 17 24574029 missense possibly damaging 0.94
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0085:Pkd1 UTSW 17 24586223 missense probably damaging 0.98
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0135:Pkd1 UTSW 17 24565071 missense possibly damaging 0.85
R0304:Pkd1 UTSW 17 24585946 missense probably damaging 1.00
R0427:Pkd1 UTSW 17 24593502 missense probably damaging 0.98
R0502:Pkd1 UTSW 17 24574792 missense probably damaging 0.99
R0518:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0521:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0544:Pkd1 UTSW 17 24585683 missense probably damaging 1.00
R0546:Pkd1 UTSW 17 24580138 missense probably benign 0.44
R0626:Pkd1 UTSW 17 24575575 missense probably damaging 0.96
R0648:Pkd1 UTSW 17 24594937 missense probably damaging 1.00
R1138:Pkd1 UTSW 17 24586032 missense probably damaging 1.00
R1302:Pkd1 UTSW 17 24568236 missense probably benign 0.00
R1306:Pkd1 UTSW 17 24573172 missense probably damaging 0.97
R1349:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1372:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1437:Pkd1 UTSW 17 24595132 missense probably damaging 1.00
R1515:Pkd1 UTSW 17 24594853 missense probably benign 0.01
R1605:Pkd1 UTSW 17 24577526 missense possibly damaging 0.95
R1622:Pkd1 UTSW 17 24581640 missense probably benign
R1623:Pkd1 UTSW 17 24578269 missense probably damaging 0.99
R1726:Pkd1 UTSW 17 24564176 missense probably damaging 0.96
R1756:Pkd1 UTSW 17 24594485 missense probably damaging 1.00
R1780:Pkd1 UTSW 17 24581569 missense probably benign
R1785:Pkd1 UTSW 17 24591099 missense probably benign 0.00
R1829:Pkd1 UTSW 17 24565584 missense probably benign
R1869:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
R1920:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1922:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1987:Pkd1 UTSW 17 24576592 splice site probably null
R1988:Pkd1 UTSW 17 24576592 splice site probably null
R1998:Pkd1 UTSW 17 24573014 missense probably damaging 1.00
R2007:Pkd1 UTSW 17 24579785 missense probably damaging 1.00
R2019:Pkd1 UTSW 17 24568684 nonsense probably null
R2054:Pkd1 UTSW 17 24574796 missense probably benign 0.00
R2061:Pkd1 UTSW 17 24569914 missense possibly damaging 0.89
R2196:Pkd1 UTSW 17 24580072 missense possibly damaging 0.60
R2203:Pkd1 UTSW 17 24580889 missense probably benign 0.01
R2301:Pkd1 UTSW 17 24574612 missense probably benign
R2655:Pkd1 UTSW 17 24576490 missense probably damaging 0.99
R2860:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R2861:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R3000:Pkd1 UTSW 17 24594486 missense probably damaging 1.00
R3150:Pkd1 UTSW 17 24579791 missense probably benign 0.00
R3747:Pkd1 UTSW 17 24591461 missense possibly damaging 0.67
R3812:Pkd1 UTSW 17 24565641 missense probably benign 0.00
R3859:Pkd1 UTSW 17 24578092 splice site probably benign
R3893:Pkd1 UTSW 17 24572110 critical splice donor site probably null
R3947:Pkd1 UTSW 17 24578037 splice site probably benign
R3949:Pkd1 UTSW 17 24578037 splice site probably benign
R4176:Pkd1 UTSW 17 24587997 missense probably benign 0.17
R4199:Pkd1 UTSW 17 24570030 missense probably benign 0.41
R4225:Pkd1 UTSW 17 24593523 missense possibly damaging 0.50
R4439:Pkd1 UTSW 17 24585692 missense probably damaging 1.00
R4476:Pkd1 UTSW 17 24576526 missense probably damaging 1.00
R4716:Pkd1 UTSW 17 24576133 missense probably damaging 1.00
R4801:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4802:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4817:Pkd1 UTSW 17 24565374 splice site probably null
R4903:Pkd1 UTSW 17 24572002 missense probably benign 0.30
R4910:Pkd1 UTSW 17 24572687 missense probably damaging 1.00
R4964:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R4966:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R5040:Pkd1 UTSW 17 24571260 missense probably benign 0.02
R5042:Pkd1 UTSW 17 24569887 missense probably benign 0.00
R5088:Pkd1 UTSW 17 24590838 missense possibly damaging 0.94
R5121:Pkd1 UTSW 17 24573463 missense probably benign
R5296:Pkd1 UTSW 17 24576074 missense probably damaging 1.00
R5338:Pkd1 UTSW 17 24594536 missense probably benign
R5356:Pkd1 UTSW 17 24593577 missense probably damaging 0.97
R5357:Pkd1 UTSW 17 24565790 missense probably damaging 1.00
R5363:Pkd1 UTSW 17 24565073 missense probably benign
R5383:Pkd1 UTSW 17 24574375 missense probably benign
R5622:Pkd1 UTSW 17 24574040 missense possibly damaging 0.67
R5651:Pkd1 UTSW 17 24591387 missense possibly damaging 0.88
R5664:Pkd1 UTSW 17 24569371 missense probably damaging 0.99
R5723:Pkd1 UTSW 17 24565523 missense probably benign 0.01
R5797:Pkd1 UTSW 17 24592641 missense possibly damaging 0.55
R5838:Pkd1 UTSW 17 24580212 missense possibly damaging 0.75
R5866:Pkd1 UTSW 17 24580961 missense probably damaging 0.99
R5873:Pkd1 UTSW 17 24569830 missense probably benign
R5906:Pkd1 UTSW 17 24572920 missense probably benign 0.16
R6047:Pkd1 UTSW 17 24595085 missense probably damaging 1.00
R6076:Pkd1 UTSW 17 24581030 missense probably benign 0.14
R6151:Pkd1 UTSW 17 24575606 missense probably benign 0.00
R6252:Pkd1 UTSW 17 24581226 missense probably damaging 0.98
R6341:Pkd1 UTSW 17 24580227 missense probably damaging 1.00
R6540:Pkd1 UTSW 17 24575977 missense probably damaging 1.00
R6732:Pkd1 UTSW 17 24569413 missense probably damaging 1.00
R6836:Pkd1 UTSW 17 24581259 missense probably damaging 1.00
R6856:Pkd1 UTSW 17 24573493 missense probably benign 0.05
R6865:Pkd1 UTSW 17 24576487 missense probably benign 0.43
R6999:Pkd1 UTSW 17 24578501 missense possibly damaging 0.62
R7077:Pkd1 UTSW 17 24591119 missense probably damaging 1.00
R7123:Pkd1 UTSW 17 24594768 missense possibly damaging 0.89
R7134:Pkd1 UTSW 17 24594112 missense probably damaging 0.99
R7210:Pkd1 UTSW 17 24575866 missense probably damaging 0.98
R7323:Pkd1 UTSW 17 24575051 missense probably benign 0.01
R7380:Pkd1 UTSW 17 24581642 missense probably damaging 1.00
R7407:Pkd1 UTSW 17 24594594 missense probably damaging 1.00
R7410:Pkd1 UTSW 17 24575881 missense probably damaging 1.00
R7492:Pkd1 UTSW 17 24569741 missense probably benign 0.04
R7517:Pkd1 UTSW 17 24580419 missense probably damaging 1.00
R7543:Pkd1 UTSW 17 24595253 missense probably damaging 0.99
R7560:Pkd1 UTSW 17 24573631 missense probably benign 0.33
R7615:Pkd1 UTSW 17 24593502 missense probably damaging 0.98
R7714:Pkd1 UTSW 17 24550276 missense unknown
R7718:Pkd1 UTSW 17 24586500 missense probably benign 0.15
R7849:Pkd1 UTSW 17 24586200 missense probably damaging 0.98
R7859:Pkd1 UTSW 17 24571280 missense probably damaging 1.00
R7866:Pkd1 UTSW 17 24590907 missense probably benign 0.26
R7915:Pkd1 UTSW 17 24592656 nonsense probably null
R7991:Pkd1 UTSW 17 24572621 missense possibly damaging 0.95
R8050:Pkd1 UTSW 17 24565643 missense probably benign 0.26
R8086:Pkd1 UTSW 17 24581214 missense probably damaging 1.00
R8312:Pkd1 UTSW 17 24567128 missense probably benign 0.02
R8385:Pkd1 UTSW 17 24575728 missense possibly damaging 0.67
R8393:Pkd1 UTSW 17 24572647 missense probably damaging 0.99
X0024:Pkd1 UTSW 17 24591392 missense possibly damaging 0.68
X0061:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
X0065:Pkd1 UTSW 17 24586164 missense probably benign 0.19
Z1088:Pkd1 UTSW 17 24565605 missense probably benign 0.44
Z1177:Pkd1 UTSW 17 24575491 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCAGCTTTTGTGGAGGTC -3'
(R):5'- GTGCATCTGTCACAGAGCAC -3'

Sequencing Primer
(F):5'- TCCAGGAGCCTGTGTTAGTCAC -3'
(R):5'- TCTGTCACAGAGCACCCAGG -3'
Posted On2019-11-12