Incidental Mutation 'R7732:Zzz3'
ID 595889
Institutional Source Beutler Lab
Gene Symbol Zzz3
Ensembl Gene ENSMUSG00000039068
Gene Name zinc finger, ZZ domain containing 3
Synonyms 3110065C23Rik, 6430567E01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7732 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 152395473-152462826 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 152448842 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 577 (Y577H)
Ref Sequence ENSEMBL: ENSMUSP00000101706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089982] [ENSMUST00000106100] [ENSMUST00000106101] [ENSMUST00000106103] [ENSMUST00000200570]
AlphaFold Q6KAQ7
Predicted Effect probably damaging
Transcript: ENSMUST00000089982
AA Change: Y577H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087428
Gene: ENSMUSG00000039068
AA Change: Y577H

DomainStartEndE-ValueType
SANT 657 711 1.42e-9 SMART
low complexity region 776 787 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
ZnF_ZZ 823 871 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106100
AA Change: Y577H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101706
Gene: ENSMUSG00000039068
AA Change: Y577H

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106101
AA Change: Y577H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101707
Gene: ENSMUSG00000039068
AA Change: Y577H

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106103
AA Change: Y76H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000101709
Gene: ENSMUSG00000039068
AA Change: Y76H

DomainStartEndE-ValueType
SANT 157 211 1.42e-9 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
ZnF_ZZ 323 371 6.46e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200570
AA Change: Y81H

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143693
Gene: ENSMUSG00000039068
AA Change: Y81H

DomainStartEndE-ValueType
SANT 161 215 1.42e-9 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
ZnF_ZZ 327 375 6.46e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A T 15: 91,191,248 S121T possibly damaging Het
Alpk1 T C 3: 127,684,392 M69V Het
Ap3m2 G T 8: 22,797,089 D192E probably benign Het
Arel1 A G 12: 84,927,889 V493A probably benign Het
Arhgap27 T C 11: 103,340,043 H140R probably benign Het
Bcat2 C T 7: 45,585,193 T166M possibly damaging Het
Brd4 C A 17: 32,221,412 A318S unknown Het
Cabp4 T A 19: 4,135,995 T270S probably benign Het
Cd22 G A 7: 30,870,057 R545C probably damaging Het
Cdc23 C A 18: 34,636,702 probably null Het
Chst4 G A 8: 110,029,882 Q450* probably null Het
Ctsc G A 7: 88,297,159 R132Q probably damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Cyp2b19 A G 7: 26,771,344 D470G possibly damaging Het
Dcc C T 18: 71,446,435 G689D probably benign Het
Disc1 G T 8: 125,250,975 G779* probably null Het
Dock1 T G 7: 134,744,970 D210E probably benign Het
Dynlt1a A G 17: 6,314,945 V14A probably benign Het
Epha10 A G 4: 124,915,299 D779G Het
Eprs A G 1: 185,372,939 H137R probably benign Het
Eps15l1 A C 8: 72,380,976 L447R probably damaging Het
Esyt1 A G 10: 128,521,825 probably null Het
Fam221a A G 6: 49,372,629 K43E probably benign Het
Fanci A G 7: 79,412,652 S309G possibly damaging Het
Fbxo48 T A 11: 16,953,601 W76R probably damaging Het
Fgd4 A G 16: 16,484,595 V32A probably benign Het
Foxe1 A T 4: 46,345,287 D365V unknown Het
Gabrd C T 4: 155,385,618 R378H probably benign Het
Gm3417 A G 17: 14,967,685 V109A probably benign Het
Greb1 A G 12: 16,673,863 S1862P probably damaging Het
H2al2b T C Y: 2,720,436 H80R possibly damaging Het
Hectd4 T C 5: 121,336,629 V2771A probably benign Het
Hoxa11 A T 6: 52,243,435 F289L probably damaging Het
Hsp90aa1 A G 12: 110,693,418 V412A probably damaging Het
Igsf11 A G 16: 39,008,798 Q77R probably damaging Het
Lrig1 C A 6: 94,626,377 M263I probably benign Het
Ms4a14 C T 19: 11,301,683 M1170I probably benign Het
Ndufs7 G A 10: 80,253,784 probably null Het
Nectin4 A T 1: 171,386,678 E467V probably benign Het
Olfr933 A G 9: 38,976,264 E196G probably damaging Het
Otogl G A 10: 107,806,664 H1302Y probably benign Het
Pigg A G 5: 108,318,975 S241G probably benign Het
Pom121l12 T A 11: 14,599,843 V183D probably damaging Het
Prickle2 T A 6: 92,411,224 E455V probably damaging Het
Ptpn4 A C 1: 119,692,802 V488G probably benign Het
Ranbp10 A G 8: 105,773,091 I502T probably benign Het
Raph1 T A 1: 60,533,288 Q40L possibly damaging Het
Rgs22 A T 15: 36,025,981 C1056S probably damaging Het
Serpinb6b G A 13: 32,968,607 S33N probably damaging Het
Serpinb6d A G 13: 33,669,099 N158S probably benign Het
Serping1 A T 2: 84,770,104 V298D probably damaging Het
Sgsm1 T A 5: 113,266,330 H637L probably benign Het
Sh3rf2 G T 18: 42,101,688 V179L probably damaging Het
Slc1a3 T C 15: 8,650,988 T129A probably benign Het
Slit1 T A 19: 41,604,408 Y1202F probably benign Het
Spsb2 T C 6: 124,809,693 S130P probably damaging Het
Sulf1 A G 1: 12,842,789 D749G probably benign Het
Taok3 A G 5: 117,193,748 E10G possibly damaging Het
Tbl3 G T 17: 24,704,162 A368D probably benign Het
Tdh T A 14: 63,496,058 H127L probably damaging Het
Tmem205 C A 9: 21,927,407 probably null Het
Tmem30a A C 9: 79,780,544 F114L possibly damaging Het
Tmem55b C T 14: 50,930,633 G48D possibly damaging Het
Tmprss15 T C 16: 79,003,420 K607E probably benign Het
Tnxb A T 17: 34,694,280 D1756V probably damaging Het
Trhde A G 10: 114,788,064 F312L probably benign Het
Ttn G A 2: 76,826,449 P12494L probably null Het
Vmn2r61 A G 7: 42,266,673 R237G probably benign Het
Vps13c A T 9: 67,940,516 N2187Y probably damaging Het
Wdr64 A G 1: 175,789,929 T692A probably benign Het
Whamm A G 7: 81,571,424 N35D probably damaging Het
Wnt2 T C 6: 18,023,336 S105G probably damaging Het
Zfp108 T A 7: 24,261,527 H514Q probably benign Het
Znfx1 T C 2: 167,042,669 K888E possibly damaging Het
Other mutations in Zzz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Zzz3 APN 3 152428514 missense probably benign 0.16
IGL00707:Zzz3 APN 3 152449043 nonsense probably null
IGL00983:Zzz3 APN 3 152455810 splice site probably benign
IGL01586:Zzz3 APN 3 152455839 missense possibly damaging 0.80
IGL01973:Zzz3 APN 3 152428370 missense probably benign 0.00
IGL02002:Zzz3 APN 3 152451369 missense probably damaging 0.98
IGL02009:Zzz3 APN 3 152428115 missense possibly damaging 0.80
IGL02260:Zzz3 APN 3 152452083 missense probably benign 0.04
IGL02336:Zzz3 APN 3 152428059 missense possibly damaging 0.74
IGL02454:Zzz3 APN 3 152428574 missense probably benign 0.03
IGL02519:Zzz3 APN 3 152427390 missense probably damaging 1.00
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0314:Zzz3 UTSW 3 152427448 missense probably benign 0.00
R0536:Zzz3 UTSW 3 152448828 missense probably damaging 1.00
R1706:Zzz3 UTSW 3 152449098 missense probably damaging 1.00
R2869:Zzz3 UTSW 3 152446844 synonymous silent
R2870:Zzz3 UTSW 3 152446844 synonymous silent
R2871:Zzz3 UTSW 3 152446844 synonymous silent
R2872:Zzz3 UTSW 3 152446844 synonymous silent
R3927:Zzz3 UTSW 3 152455862 missense probably damaging 1.00
R4195:Zzz3 UTSW 3 152428465 missense probably benign 0.02
R4768:Zzz3 UTSW 3 152448783 missense probably damaging 1.00
R5248:Zzz3 UTSW 3 152427545 missense probably damaging 0.99
R5566:Zzz3 UTSW 3 152455824 missense probably damaging 1.00
R5752:Zzz3 UTSW 3 152452122 missense possibly damaging 0.48
R5782:Zzz3 UTSW 3 152428100 missense possibly damaging 0.69
R5884:Zzz3 UTSW 3 152450658 missense probably damaging 1.00
R6008:Zzz3 UTSW 3 152428151 missense probably benign 0.01
R6155:Zzz3 UTSW 3 152427682 missense possibly damaging 0.57
R6557:Zzz3 UTSW 3 152428460 missense probably damaging 1.00
R6865:Zzz3 UTSW 3 152428053 missense probably benign 0.01
R7344:Zzz3 UTSW 3 152452099 missense probably damaging 0.98
R7588:Zzz3 UTSW 3 152422768 missense possibly damaging 0.85
R7636:Zzz3 UTSW 3 152427652 missense probably benign
R8157:Zzz3 UTSW 3 152449648 missense probably null 0.71
R8490:Zzz3 UTSW 3 152428653 nonsense probably null
R8926:Zzz3 UTSW 3 152427892 missense possibly damaging 0.76
R9143:Zzz3 UTSW 3 152458271 missense probably benign 0.04
R9243:Zzz3 UTSW 3 152428283 missense probably damaging 1.00
X0018:Zzz3 UTSW 3 152428733 missense possibly damaging 0.88
Z1176:Zzz3 UTSW 3 152449097 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TATAAAGTTGCTGCCGGTACAC -3'
(R):5'- TTTTGGTCTAGCGGGCAAC -3'

Sequencing Primer
(F):5'- CACGTCGTATTTAGCACTCTATGAG -3'
(R):5'- GGACACTACAAGACATTTTC -3'
Posted On 2019-11-12