Incidental Mutation 'R7732:Otogl'
ID595920
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7732 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107806664 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 1302 (H1302Y)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
Predicted Effect probably benign
Transcript: ENSMUST00000165341
AA Change: H1302Y

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: H1302Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A T 15: 91,191,248 S121T possibly damaging Het
Alpk1 T C 3: 127,684,392 M69V Het
Ap3m2 G T 8: 22,797,089 D192E probably benign Het
Arel1 A G 12: 84,927,889 V493A probably benign Het
Arhgap27 T C 11: 103,340,043 H140R probably benign Het
Bcat2 C T 7: 45,585,193 T166M possibly damaging Het
Brd4 C A 17: 32,221,412 A318S unknown Het
Cabp4 T A 19: 4,135,995 T270S probably benign Het
Cd22 G A 7: 30,870,057 R545C probably damaging Het
Cdc23 C A 18: 34,636,702 probably null Het
Chst4 G A 8: 110,029,882 Q450* probably null Het
Ctsc G A 7: 88,297,159 R132Q probably damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Cyp2b19 A G 7: 26,771,344 D470G possibly damaging Het
Dcc C T 18: 71,446,435 G689D probably benign Het
Disc1 G T 8: 125,250,975 G779* probably null Het
Dock1 T G 7: 134,744,970 D210E probably benign Het
Dynlt1a A G 17: 6,314,945 V14A probably benign Het
Epha10 A G 4: 124,915,299 D779G Het
Eprs A G 1: 185,372,939 H137R probably benign Het
Eps15l1 A C 8: 72,380,976 L447R probably damaging Het
Esyt1 A G 10: 128,521,825 probably null Het
Fam221a A G 6: 49,372,629 K43E probably benign Het
Fanci A G 7: 79,412,652 S309G possibly damaging Het
Fbxo48 T A 11: 16,953,601 W76R probably damaging Het
Fgd4 A G 16: 16,484,595 V32A probably benign Het
Foxe1 A T 4: 46,345,287 D365V unknown Het
Gabrd C T 4: 155,385,618 R378H probably benign Het
Gm3417 A G 17: 14,967,685 V109A probably benign Het
Greb1 A G 12: 16,673,863 S1862P probably damaging Het
H2al2b T C Y: 2,720,436 H80R possibly damaging Het
Hectd4 T C 5: 121,336,629 V2771A probably benign Het
Hoxa11 A T 6: 52,243,435 F289L probably damaging Het
Hsp90aa1 A G 12: 110,693,418 V412A probably damaging Het
Igsf11 A G 16: 39,008,798 Q77R probably damaging Het
Lrig1 C A 6: 94,626,377 M263I probably benign Het
Ms4a14 C T 19: 11,301,683 M1170I probably benign Het
Ndufs7 G A 10: 80,253,784 probably null Het
Nectin4 A T 1: 171,386,678 E467V probably benign Het
Olfr933 A G 9: 38,976,264 E196G probably damaging Het
Pigg A G 5: 108,318,975 S241G probably benign Het
Pom121l12 T A 11: 14,599,843 V183D probably damaging Het
Prickle2 T A 6: 92,411,224 E455V probably damaging Het
Ptpn4 A C 1: 119,692,802 V488G probably benign Het
Ranbp10 A G 8: 105,773,091 I502T probably benign Het
Raph1 T A 1: 60,533,288 Q40L possibly damaging Het
Rgs22 A T 15: 36,025,981 C1056S probably damaging Het
Serpinb6b G A 13: 32,968,607 S33N probably damaging Het
Serpinb6d A G 13: 33,669,099 N158S probably benign Het
Serping1 A T 2: 84,770,104 V298D probably damaging Het
Sgsm1 T A 5: 113,266,330 H637L probably benign Het
Sh3rf2 G T 18: 42,101,688 V179L probably damaging Het
Slc1a3 T C 15: 8,650,988 T129A probably benign Het
Slit1 T A 19: 41,604,408 Y1202F probably benign Het
Spsb2 T C 6: 124,809,693 S130P probably damaging Het
Sulf1 A G 1: 12,842,789 D749G probably benign Het
Taok3 A G 5: 117,193,748 E10G possibly damaging Het
Tbl3 G T 17: 24,704,162 A368D probably benign Het
Tdh T A 14: 63,496,058 H127L probably damaging Het
Tmem205 C A 9: 21,927,407 probably null Het
Tmem30a A C 9: 79,780,544 F114L possibly damaging Het
Tmem55b C T 14: 50,930,633 G48D possibly damaging Het
Tmprss15 T C 16: 79,003,420 K607E probably benign Het
Tnxb A T 17: 34,694,280 D1756V probably damaging Het
Trhde A G 10: 114,788,064 F312L probably benign Het
Ttn G A 2: 76,826,449 P12494L probably null Het
Vmn2r61 A G 7: 42,266,673 R237G probably benign Het
Vps13c A T 9: 67,940,516 N2187Y probably damaging Het
Wdr64 A G 1: 175,789,929 T692A probably benign Het
Whamm A G 7: 81,571,424 N35D probably damaging Het
Wnt2 T C 6: 18,023,336 S105G probably damaging Het
Zfp108 T A 7: 24,261,527 H514Q probably benign Het
Znfx1 T C 2: 167,042,669 K888E possibly damaging Het
Zzz3 T C 3: 152,448,842 Y577H probably damaging Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1664:Otogl UTSW 10 107806576 missense probably benign 0.00
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1764:Otogl UTSW 10 107899461 nonsense probably null
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1875:Otogl UTSW 10 107899590 missense probably damaging 1.00
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R1986:Otogl UTSW 10 107794190 critical splice acceptor site probably null
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2117:Otogl UTSW 10 107858918 missense probably benign 0.06
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2508:Otogl UTSW 10 107874500 missense probably damaging 0.99
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4910:Otogl UTSW 10 107879517 missense probably benign 0.05
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5690:Otogl UTSW 10 107777117 synonymous silent
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6226:Otogl UTSW 10 107771206 nonsense probably null
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6727:Otogl UTSW 10 107777117 synonymous silent
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6795:Otogl UTSW 10 107777117 synonymous silent
R6797:Otogl UTSW 10 107777117 synonymous silent
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
R7000:Otogl UTSW 10 107779831 missense probably benign
R7075:Otogl UTSW 10 107778929 missense probably benign 0.16
R7122:Otogl UTSW 10 107866654 missense probably benign 0.08
R7176:Otogl UTSW 10 107778911 missense probably damaging 1.00
R7184:Otogl UTSW 10 107763200 missense probably damaging 1.00
R7199:Otogl UTSW 10 107874533 missense possibly damaging 0.88
R7252:Otogl UTSW 10 107821943 missense probably benign 0.06
R7286:Otogl UTSW 10 107770610 missense probably benign 0.00
R7373:Otogl UTSW 10 107901251 missense probably damaging 1.00
R7449:Otogl UTSW 10 107803663 missense probably damaging 1.00
R7486:Otogl UTSW 10 107821988 missense probably damaging 1.00
R7493:Otogl UTSW 10 107886982 missense probably benign 0.06
R7659:Otogl UTSW 10 107777120 missense probably benign 0.19
R7754:Otogl UTSW 10 107869546 missense probably damaging 0.99
R7757:Otogl UTSW 10 107876921 missense probably damaging 1.00
R7800:Otogl UTSW 10 107886515 missense probably damaging 0.99
R7864:Otogl UTSW 10 107869567 missense probably damaging 1.00
R7879:Otogl UTSW 10 107777109 missense probably benign 0.00
R7941:Otogl UTSW 10 107806802 splice site probably null
R7956:Otogl UTSW 10 107878026 missense possibly damaging 0.62
R7988:Otogl UTSW 10 107895776 missense probably damaging 1.00
R8057:Otogl UTSW 10 107808615 missense probably benign 0.00
R8058:Otogl UTSW 10 107762426 missense probably damaging 1.00
R8127:Otogl UTSW 10 107895752 missense probably damaging 1.00
R8143:Otogl UTSW 10 107806666 missense probably damaging 1.00
R8310:Otogl UTSW 10 107777600 missense possibly damaging 0.94
R8319:Otogl UTSW 10 107853266 critical splice donor site probably null
R8339:Otogl UTSW 10 107789535 missense probably damaging 0.99
R8339:Otogl UTSW 10 107789536 missense probably benign 0.34
R8394:Otogl UTSW 10 107886465 critical splice donor site probably null
R8428:Otogl UTSW 10 107798736 missense probably damaging 1.00
R8444:Otogl UTSW 10 107857114 missense probably benign 0.01
R8501:Otogl UTSW 10 107790560 missense probably benign
R8503:Otogl UTSW 10 107892126 missense probably damaging 1.00
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Z1176:Otogl UTSW 10 107777213 missense probably benign
Z1176:Otogl UTSW 10 107778873 missense probably damaging 0.97
Z1176:Otogl UTSW 10 107789032 missense probably benign 0.00
Z1177:Otogl UTSW 10 107763258 nonsense probably null
Z1177:Otogl UTSW 10 107853397 missense possibly damaging 0.78
Z1177:Otogl UTSW 10 107876903 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCCTAAGAATCTGTGCTCCTC -3'
(R):5'- ACTGCATATTATAAGGCCCTTGC -3'

Sequencing Primer
(F):5'- CTCTTTGGAGCACTCGGGAAG -3'
(R):5'- CCTGTGTTTTGCCTTTCTCTGAGG -3'
Posted On2019-11-12