Incidental Mutation 'R7732:Serpinb6b'
ID 595929
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock # R7732 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 32965209-32979067 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32968607 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 33 (S33N)
Ref Sequence ENSEMBL: ENSMUSP00000105922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017184] [ENSMUST00000110293] [ENSMUST00000164541]
AlphaFold O08804
Predicted Effect probably damaging
Transcript: ENSMUST00000017184
AA Change: S33N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017184
Gene: ENSMUSG00000042842
AA Change: S33N

DomainStartEndE-ValueType
SERPIN 13 208 1.22e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110293
AA Change: S33N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105922
Gene: ENSMUSG00000042842
AA Change: S33N

DomainStartEndE-ValueType
SERPIN 13 377 1.99e-174 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164541
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A T 15: 91,191,248 S121T possibly damaging Het
Alpk1 T C 3: 127,684,392 M69V Het
Ap3m2 G T 8: 22,797,089 D192E probably benign Het
Arel1 A G 12: 84,927,889 V493A probably benign Het
Arhgap27 T C 11: 103,340,043 H140R probably benign Het
Bcat2 C T 7: 45,585,193 T166M possibly damaging Het
Brd4 C A 17: 32,221,412 A318S unknown Het
Cabp4 T A 19: 4,135,995 T270S probably benign Het
Cd22 G A 7: 30,870,057 R545C probably damaging Het
Cdc23 C A 18: 34,636,702 probably null Het
Chst4 G A 8: 110,029,882 Q450* probably null Het
Ctsc G A 7: 88,297,159 R132Q probably damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Cyp2b19 A G 7: 26,771,344 D470G possibly damaging Het
Dcc C T 18: 71,446,435 G689D probably benign Het
Disc1 G T 8: 125,250,975 G779* probably null Het
Dock1 T G 7: 134,744,970 D210E probably benign Het
Dynlt1a A G 17: 6,314,945 V14A probably benign Het
Epha10 A G 4: 124,915,299 D779G Het
Eprs A G 1: 185,372,939 H137R probably benign Het
Eps15l1 A C 8: 72,380,976 L447R probably damaging Het
Esyt1 A G 10: 128,521,825 probably null Het
Fam221a A G 6: 49,372,629 K43E probably benign Het
Fanci A G 7: 79,412,652 S309G possibly damaging Het
Fbxo48 T A 11: 16,953,601 W76R probably damaging Het
Fgd4 A G 16: 16,484,595 V32A probably benign Het
Foxe1 A T 4: 46,345,287 D365V unknown Het
Gabrd C T 4: 155,385,618 R378H probably benign Het
Gm3417 A G 17: 14,967,685 V109A probably benign Het
Greb1 A G 12: 16,673,863 S1862P probably damaging Het
H2al2b T C Y: 2,720,436 H80R possibly damaging Het
Hectd4 T C 5: 121,336,629 V2771A probably benign Het
Hoxa11 A T 6: 52,243,435 F289L probably damaging Het
Hsp90aa1 A G 12: 110,693,418 V412A probably damaging Het
Igsf11 A G 16: 39,008,798 Q77R probably damaging Het
Lrig1 C A 6: 94,626,377 M263I probably benign Het
Ms4a14 C T 19: 11,301,683 M1170I probably benign Het
Ndufs7 G A 10: 80,253,784 probably null Het
Nectin4 A T 1: 171,386,678 E467V probably benign Het
Olfr933 A G 9: 38,976,264 E196G probably damaging Het
Otogl G A 10: 107,806,664 H1302Y probably benign Het
Pigg A G 5: 108,318,975 S241G probably benign Het
Pom121l12 T A 11: 14,599,843 V183D probably damaging Het
Prickle2 T A 6: 92,411,224 E455V probably damaging Het
Ptpn4 A C 1: 119,692,802 V488G probably benign Het
Ranbp10 A G 8: 105,773,091 I502T probably benign Het
Raph1 T A 1: 60,533,288 Q40L possibly damaging Het
Rgs22 A T 15: 36,025,981 C1056S probably damaging Het
Serpinb6d A G 13: 33,669,099 N158S probably benign Het
Serping1 A T 2: 84,770,104 V298D probably damaging Het
Sgsm1 T A 5: 113,266,330 H637L probably benign Het
Sh3rf2 G T 18: 42,101,688 V179L probably damaging Het
Slc1a3 T C 15: 8,650,988 T129A probably benign Het
Slit1 T A 19: 41,604,408 Y1202F probably benign Het
Spsb2 T C 6: 124,809,693 S130P probably damaging Het
Sulf1 A G 1: 12,842,789 D749G probably benign Het
Taok3 A G 5: 117,193,748 E10G possibly damaging Het
Tbl3 G T 17: 24,704,162 A368D probably benign Het
Tdh T A 14: 63,496,058 H127L probably damaging Het
Tmem205 C A 9: 21,927,407 probably null Het
Tmem30a A C 9: 79,780,544 F114L possibly damaging Het
Tmem55b C T 14: 50,930,633 G48D possibly damaging Het
Tmprss15 T C 16: 79,003,420 K607E probably benign Het
Tnxb A T 17: 34,694,280 D1756V probably damaging Het
Trhde A G 10: 114,788,064 F312L probably benign Het
Ttn G A 2: 76,826,449 P12494L probably null Het
Vmn2r61 A G 7: 42,266,673 R237G probably benign Het
Vps13c A T 9: 67,940,516 N2187Y probably damaging Het
Wdr64 A G 1: 175,789,929 T692A probably benign Het
Whamm A G 7: 81,571,424 N35D probably damaging Het
Wnt2 T C 6: 18,023,336 S105G probably damaging Het
Zfp108 T A 7: 24,261,527 H514Q probably benign Het
Znfx1 T C 2: 167,042,669 K888E possibly damaging Het
Zzz3 T C 3: 152,448,842 Y577H probably damaging Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 32971546 missense probably benign 0.01
IGL01077:Serpinb6b APN 13 32978066 missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 32974948 missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 32971606 missense probably benign 0.34
R0308:Serpinb6b UTSW 13 32978237 missense probably benign 0.09
R1568:Serpinb6b UTSW 13 32974912 missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 32974995 missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 32978058 missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 32978240 missense probably benign
R1918:Serpinb6b UTSW 13 32978240 missense probably benign
R1919:Serpinb6b UTSW 13 32978240 missense probably benign
R1920:Serpinb6b UTSW 13 32975008 missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 32968568 missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 32972263 missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 32978150 missense probably benign
R5503:Serpinb6b UTSW 13 32977659 missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 32977558 nonsense probably null
R6061:Serpinb6b UTSW 13 32977994 missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 32972272 missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 32971615 missense probably benign 0.09
R7248:Serpinb6b UTSW 13 32977576 missense probably benign 0.23
R7315:Serpinb6b UTSW 13 32972257 missense probably benign 0.41
R7424:Serpinb6b UTSW 13 32968667 missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 32974924 missense probably benign 0.05
R7770:Serpinb6b UTSW 13 32977529 missense probably benign 0.05
R7802:Serpinb6b UTSW 13 32971596
R8814:Serpinb6b UTSW 13 32978304 missense possibly damaging 0.94
R8966:Serpinb6b UTSW 13 32978052 missense probably damaging 1.00
R8988:Serpinb6b UTSW 13 32978142 missense probably benign 0.45
R9037:Serpinb6b UTSW 13 32978015 nonsense probably null
R9129:Serpinb6b UTSW 13 32978156 small deletion probably benign
R9377:Serpinb6b UTSW 13 32968511 start codon destroyed probably null 1.00
R9415:Serpinb6b UTSW 13 32975019 missense
Predicted Primers PCR Primer
(F):5'- TGTCAGTGGCAGCAAAGATG -3'
(R):5'- TGGTCAAAATACTCATGCCAGG -3'

Sequencing Primer
(F):5'- GCAGGTTGCATATTAATTACCCC -3'
(R):5'- AGCAGGGCTAGCACATCCTTC -3'
Posted On 2019-11-12