Incidental Mutation 'R7732:Cyhr1'
ID595935
Institutional Source Beutler Lab
Gene Symbol Cyhr1
Ensembl Gene ENSMUSG00000053929
Gene Namecysteine and histidine rich 1
Synonyms1110031M01Rik, Chrp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R7732 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76643395-76660117 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76648186 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 241 (D241N)
Ref Sequence ENSEMBL: ENSMUSP00000134739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081291] [ENSMUST00000176274] [ENSMUST00000229524]
Predicted Effect probably benign
Transcript: ENSMUST00000081291
AA Change: D153N

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080043
Gene: ENSMUSG00000053929
AA Change: D153N

DomainStartEndE-ValueType
SCOP:d1jm7a_ 21 88 3e-5 SMART
Blast:RING 27 62 8e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176274
AA Change: D241N

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134739
Gene: ENSMUSG00000053929
AA Change: D241N

DomainStartEndE-ValueType
low complexity region 3 48 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
RING 106 150 1.9e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000229524
AA Change: D241N

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A T 15: 91,191,248 S121T possibly damaging Het
Alpk1 T C 3: 127,684,392 M69V Het
Ap3m2 G T 8: 22,797,089 D192E probably benign Het
Arel1 A G 12: 84,927,889 V493A probably benign Het
Arhgap27 T C 11: 103,340,043 H140R probably benign Het
Bcat2 C T 7: 45,585,193 T166M possibly damaging Het
Brd4 C A 17: 32,221,412 A318S unknown Het
Cabp4 T A 19: 4,135,995 T270S probably benign Het
Cd22 G A 7: 30,870,057 R545C probably damaging Het
Cdc23 C A 18: 34,636,702 probably null Het
Chst4 G A 8: 110,029,882 Q450* probably null Het
Ctsc G A 7: 88,297,159 R132Q probably damaging Het
Cyp2b19 A G 7: 26,771,344 D470G possibly damaging Het
Dcc C T 18: 71,446,435 G689D probably benign Het
Disc1 G T 8: 125,250,975 G779* probably null Het
Dock1 T G 7: 134,744,970 D210E probably benign Het
Dynlt1a A G 17: 6,314,945 V14A probably benign Het
Epha10 A G 4: 124,915,299 D779G Het
Eprs A G 1: 185,372,939 H137R probably benign Het
Eps15l1 A C 8: 72,380,976 L447R probably damaging Het
Esyt1 A G 10: 128,521,825 probably null Het
Fam221a A G 6: 49,372,629 K43E probably benign Het
Fanci A G 7: 79,412,652 S309G possibly damaging Het
Fbxo48 T A 11: 16,953,601 W76R probably damaging Het
Fgd4 A G 16: 16,484,595 V32A probably benign Het
Foxe1 A T 4: 46,345,287 D365V unknown Het
Gabrd C T 4: 155,385,618 R378H probably benign Het
Gm3417 A G 17: 14,967,685 V109A probably benign Het
Greb1 A G 12: 16,673,863 S1862P probably damaging Het
H2al2b T C Y: 2,720,436 H80R possibly damaging Het
Hectd4 T C 5: 121,336,629 V2771A probably benign Het
Hoxa11 A T 6: 52,243,435 F289L probably damaging Het
Hsp90aa1 A G 12: 110,693,418 V412A probably damaging Het
Igsf11 A G 16: 39,008,798 Q77R probably damaging Het
Lrig1 C A 6: 94,626,377 M263I probably benign Het
Ms4a14 C T 19: 11,301,683 M1170I probably benign Het
Ndufs7 G A 10: 80,253,784 probably null Het
Nectin4 A T 1: 171,386,678 E467V probably benign Het
Olfr933 A G 9: 38,976,264 E196G probably damaging Het
Otogl G A 10: 107,806,664 H1302Y probably benign Het
Pigg A G 5: 108,318,975 S241G probably benign Het
Pom121l12 T A 11: 14,599,843 V183D probably damaging Het
Prickle2 T A 6: 92,411,224 E455V probably damaging Het
Ptpn4 A C 1: 119,692,802 V488G probably benign Het
Ranbp10 A G 8: 105,773,091 I502T probably benign Het
Raph1 T A 1: 60,533,288 Q40L possibly damaging Het
Rgs22 A T 15: 36,025,981 C1056S probably damaging Het
Serpinb6b G A 13: 32,968,607 S33N probably damaging Het
Serpinb6d A G 13: 33,669,099 N158S probably benign Het
Serping1 A T 2: 84,770,104 V298D probably damaging Het
Sgsm1 T A 5: 113,266,330 H637L probably benign Het
Sh3rf2 G T 18: 42,101,688 V179L probably damaging Het
Slc1a3 T C 15: 8,650,988 T129A probably benign Het
Slit1 T A 19: 41,604,408 Y1202F probably benign Het
Spsb2 T C 6: 124,809,693 S130P probably damaging Het
Sulf1 A G 1: 12,842,789 D749G probably benign Het
Taok3 A G 5: 117,193,748 E10G possibly damaging Het
Tbl3 G T 17: 24,704,162 A368D probably benign Het
Tdh T A 14: 63,496,058 H127L probably damaging Het
Tmem205 C A 9: 21,927,407 probably null Het
Tmem30a A C 9: 79,780,544 F114L possibly damaging Het
Tmem55b C T 14: 50,930,633 G48D possibly damaging Het
Tmprss15 T C 16: 79,003,420 K607E probably benign Het
Tnxb A T 17: 34,694,280 D1756V probably damaging Het
Trhde A G 10: 114,788,064 F312L probably benign Het
Ttn G A 2: 76,826,449 P12494L probably null Het
Vmn2r61 A G 7: 42,266,673 R237G probably benign Het
Vps13c A T 9: 67,940,516 N2187Y probably damaging Het
Wdr64 A G 1: 175,789,929 T692A probably benign Het
Whamm A G 7: 81,571,424 N35D probably damaging Het
Wnt2 T C 6: 18,023,336 S105G probably damaging Het
Zfp108 T A 7: 24,261,527 H514Q probably benign Het
Znfx1 T C 2: 167,042,669 K888E possibly damaging Het
Zzz3 T C 3: 152,448,842 Y577H probably damaging Het
Other mutations in Cyhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cyhr1 APN 15 76646538 missense probably damaging 1.00
IGL03163:Cyhr1 APN 15 76659274 missense probably damaging 0.97
R0107:Cyhr1 UTSW 15 76646347 missense possibly damaging 0.90
R0445:Cyhr1 UTSW 15 76648257 missense probably damaging 1.00
R0759:Cyhr1 UTSW 15 76646185 makesense probably null
R1327:Cyhr1 UTSW 15 76649176 missense probably damaging 0.98
R1366:Cyhr1 UTSW 15 76648969 missense probably damaging 0.96
R1950:Cyhr1 UTSW 15 76659217 critical splice donor site probably null
R3416:Cyhr1 UTSW 15 76658715 splice site probably null
R5092:Cyhr1 UTSW 15 76646312 missense probably benign 0.11
R5749:Cyhr1 UTSW 15 76658644 splice site probably null
R5860:Cyhr1 UTSW 15 76648191 missense probably damaging 1.00
R5860:Cyhr1 UTSW 15 76656415 missense probably damaging 1.00
R6032:Cyhr1 UTSW 15 76658858 missense probably damaging 0.99
R6032:Cyhr1 UTSW 15 76658858 missense probably damaging 0.99
R6397:Cyhr1 UTSW 15 76648191 missense probably damaging 1.00
R6481:Cyhr1 UTSW 15 76658708 splice site probably null
R6533:Cyhr1 UTSW 15 76647730 nonsense probably null
R7466:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7484:Cyhr1 UTSW 15 76646235 missense probably damaging 1.00
R7629:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7763:Cyhr1 UTSW 15 76658547 missense probably damaging 0.99
R7861:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AGGAGCCATGCAGGTACATC -3'
(R):5'- TTGTTCCAGCCACAGAGTTG -3'

Sequencing Primer
(F):5'- ACTGCCCAGAGCCTACTG -3'
(R):5'- GTTCCAGCCACAGAGTTGATCAC -3'
Posted On2019-11-12