Incidental Mutation 'R0242:Tm9sf1'
ID59594
Institutional Source Beutler Lab
Gene Symbol Tm9sf1
Ensembl Gene ENSMUSG00000002320
Gene Nametransmembrane 9 superfamily member 1
Synonyms1200014D02Rik, MP70
MMRRC Submission 038480-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R0242 (G1)
Quality Score222
Status Validated
Chromosome14
Chromosomal Location55635965-55643806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55637935 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 451 (A451T)
Ref Sequence ENSEMBL: ENSMUSP00000118427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002391] [ENSMUST00000047131] [ENSMUST00000120041] [ENSMUST00000121791] [ENSMUST00000121937] [ENSMUST00000122358] [ENSMUST00000125133] [ENSMUST00000132338] [ENSMUST00000133707] [ENSMUST00000135221] [ENSMUST00000138085] [ENSMUST00000148351] [ENSMUST00000149726]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002391
AA Change: A451T

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002391
Gene: ENSMUSG00000002320
AA Change: A451T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047131
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120041
AA Change: A451T

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112893
Gene: ENSMUSG00000002320
AA Change: A451T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121791
AA Change: A451T

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112764
Gene: ENSMUSG00000002320
AA Change: A451T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121937
AA Change: A451T

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113143
Gene: ENSMUSG00000002320
AA Change: A451T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 547 9e-169 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122358
AA Change: A451T

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113782
Gene: ENSMUSG00000002320
AA Change: A451T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 58 563 2.3e-164 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130167
Predicted Effect possibly damaging
Transcript: ENSMUST00000132338
AA Change: A451T

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118427
Gene: ENSMUSG00000002320
AA Change: A451T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 477 9.2e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133707
SMART Domains Protein: ENSMUSP00000123471
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 118 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135221
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138085
SMART Domains Protein: ENSMUSP00000119435
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 172 2.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139313
Predicted Effect probably benign
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148942
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149726
SMART Domains Protein: ENSMUSP00000115403
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 390 1.7e-103 PFAM
Meta Mutation Damage Score 0.5626 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,676 D230G probably benign Het
4930435E12Rik C T 16: 38,824,567 probably benign Het
Abhd13 A G 8: 9,987,561 I53V probably benign Het
Adgrl2 A C 3: 148,839,185 probably null Het
Aldh16a1 G A 7: 45,144,664 A596V probably damaging Het
Aldh3b2 T A 19: 3,979,414 Y262* probably null Het
Ambn A G 5: 88,467,972 Q420R possibly damaging Het
Ankib1 A C 5: 3,700,344 probably benign Het
Arhgap9 C A 10: 127,329,538 H430Q probably benign Het
Arhgef25 C T 10: 127,184,064 G435E probably damaging Het
Armc12 A T 17: 28,532,392 D120V possibly damaging Het
Armc4 A T 18: 7,211,516 V786D probably damaging Het
Asxl3 G A 18: 22,516,681 E576K possibly damaging Het
Bcdin3d T C 15: 99,470,895 E141G probably benign Het
Bmpr1b G A 3: 141,840,676 T483M probably damaging Het
Caprin2 C T 6: 148,842,954 S991N probably damaging Het
Cd96 T C 16: 46,071,766 I286M possibly damaging Het
Cdcp1 G T 9: 123,180,172 F480L probably benign Het
Celf5 T C 10: 81,464,409 T258A probably benign Het
Cgnl1 A G 9: 71,721,657 V577A probably damaging Het
Clca3b A G 3: 144,841,465 S304P probably benign Het
Cmya5 A T 13: 93,095,600 H993Q probably benign Het
Cnbp A T 6: 87,845,764 C6S probably damaging Het
Col14a1 C T 15: 55,497,511 R1605W probably damaging Het
Cops7a T C 6: 124,964,854 N11S probably benign Het
Coro7 T C 16: 4,630,178 probably benign Het
Cpvl T C 6: 53,932,500 H217R possibly damaging Het
Cuedc1 T C 11: 88,184,621 probably benign Het
Cyp2c66 A G 19: 39,141,925 Y68C probably damaging Het
Dicer1 G A 12: 104,702,451 T1324M probably benign Het
Dlgap2 A G 8: 14,727,562 D268G probably benign Het
Dnm1 T A 2: 32,316,989 M535L possibly damaging Het
Dock7 A T 4: 98,962,280 F1575Y probably benign Het
Dpp10 T A 1: 123,398,546 H403L possibly damaging Het
Dync1h1 A G 12: 110,649,851 D3112G possibly damaging Het
Eno3 A G 11: 70,657,935 E21G probably null Het
Fam120b T A 17: 15,422,924 V655D probably damaging Het
Fam129a A G 1: 151,718,216 D884G probably benign Het
Fkbp5 A T 17: 28,428,452 D136E probably benign Het
Gdap1l1 T A 2: 163,447,653 Y179* probably null Het
Gfer A G 17: 24,694,303 W192R probably damaging Het
Gm4782 A G 6: 50,609,858 T408A probably benign Het
Golgb1 C T 16: 36,875,630 Q164* probably null Het
Gpnmb A G 6: 49,047,342 N197S probably damaging Het
Gtf2f1 G A 17: 57,003,802 T414M probably benign Het
Hc A G 2: 35,036,154 probably benign Het
Hcfc1 A T X: 73,948,429 probably benign Het
Helz2 C T 2: 181,230,430 R2539Q probably damaging Het
Hsd17b12 T A 2: 94,157,815 I19F probably benign Het
Incenp T C 19: 9,893,750 T172A unknown Het
Jmy A G 13: 93,441,618 Y681H probably benign Het
Kbtbd11 A G 8: 15,027,508 T36A probably benign Het
Kcnh4 T C 11: 100,755,699 D267G probably damaging Het
Krt34 C T 11: 100,041,331 E56K probably damaging Het
Krt40 T A 11: 99,538,742 E335D probably damaging Het
Krt86 T A 15: 101,476,573 Y282* probably null Het
Lgi3 C T 14: 70,534,815 R267* probably null Het
Lnpk A G 2: 74,537,289 probably benign Het
Lrp1b T A 2: 40,998,183 H2355L probably benign Het
Lrrc8e G A 8: 4,235,401 R542H probably benign Het
Mia2 T C 12: 59,108,856 Y452H probably damaging Het
Mmachc C T 4: 116,704,541 R132Q probably damaging Het
Mtbp T A 15: 55,577,486 N356K possibly damaging Het
Mum1 T C 10: 80,234,258 S354P probably benign Het
Myo5b A G 18: 74,661,716 H552R possibly damaging Het
Noxred1 A G 12: 87,226,979 V96A probably benign Het
Nr1d2 T A 14: 18,211,933 D390V possibly damaging Het
Oas1e A T 5: 120,791,774 probably benign Het
Olfr398 T C 11: 73,983,712 S299G probably benign Het
Olfr786 T A 10: 129,437,348 Y179N probably damaging Het
Otog G T 7: 46,267,381 C914F probably damaging Het
Pank2 G T 2: 131,280,197 C214F probably damaging Het
Pcdhb1 T A 18: 37,266,735 S580T probably benign Het
Pdia3 T C 2: 121,414,111 S2P probably damaging Het
Peli1 G T 11: 21,142,602 R83L probably damaging Het
Pla2g3 T A 11: 3,491,935 C366* probably null Het
Pon3 T A 6: 5,240,860 D107V probably benign Het
Ppip5k2 A G 1: 97,741,091 C532R probably damaging Het
Prph A T 15: 99,055,727 D174V probably damaging Het
Psd3 A G 8: 67,758,086 M270T probably damaging Het
Pum3 A G 19: 27,422,755 probably benign Het
Pus1 A T 5: 110,779,798 H30Q probably benign Het
Rab7 A T 6: 88,005,132 V87E probably damaging Het
Rbm5 A T 9: 107,751,708 probably benign Het
Reln A G 5: 21,942,597 probably null Het
S1pr3 A G 13: 51,418,902 T40A probably benign Het
Sdk1 T A 5: 142,143,922 probably benign Het
Senp7 T A 16: 56,179,521 I853N probably damaging Het
Serpinb6c T A 13: 33,899,247 probably benign Het
Shroom1 T G 11: 53,465,485 probably null Het
Slc24a3 T C 2: 145,606,664 I376T probably benign Het
Slc46a1 T C 11: 78,468,667 I375T possibly damaging Het
Slc4a9 T C 18: 36,533,680 F527S probably damaging Het
Slc4a9 T A 18: 36,541,233 I924N probably damaging Het
Slx4 T A 16: 3,986,952 E666V probably damaging Het
Snrnp27 G A 6: 86,675,593 probably benign Het
Sorcs1 C T 19: 50,228,221 G640E probably damaging Het
Sptan1 A T 2: 30,018,401 M1725L probably benign Het
Sync G A 4: 129,293,721 R182K probably damaging Het
Syne2 G A 12: 76,098,034 G1586S probably damaging Het
Sytl1 G T 4: 133,253,457 T522K probably damaging Het
Tex2 T A 11: 106,519,955 K414* probably null Het
Thegl G T 5: 77,016,305 E52* probably null Het
Thsd7a G A 6: 12,503,916 T413I probably benign Het
Ttn A T 2: 76,826,152 probably benign Het
Uba2 T C 7: 34,154,629 I140V possibly damaging Het
Ushbp1 C A 8: 71,390,118 G361* probably null Het
Wbp2nl C T 15: 82,313,787 A175V probably benign Het
Zc3h12d A G 10: 7,862,566 E212G probably damaging Het
Zc3h7b T C 15: 81,768,830 probably benign Het
Other mutations in Tm9sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Tm9sf1 APN 14 55642727 missense probably damaging 1.00
IGL01102:Tm9sf1 APN 14 55642767 missense probably damaging 1.00
IGL02263:Tm9sf1 APN 14 55642935 missense possibly damaging 0.95
R0242:Tm9sf1 UTSW 14 55637935 missense possibly damaging 0.90
R0469:Tm9sf1 UTSW 14 55641429 missense possibly damaging 0.87
R0928:Tm9sf1 UTSW 14 55636457 missense probably damaging 1.00
R0973:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R0973:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R0974:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R1441:Tm9sf1 UTSW 14 55636325 missense probably damaging 1.00
R1644:Tm9sf1 UTSW 14 55641300 missense probably benign 0.03
R1873:Tm9sf1 UTSW 14 55636223 missense probably damaging 1.00
R2176:Tm9sf1 UTSW 14 55641409 missense possibly damaging 0.89
R2973:Tm9sf1 UTSW 14 55641114 missense probably benign 0.01
R4284:Tm9sf1 UTSW 14 55641323 missense probably damaging 1.00
R4545:Tm9sf1 UTSW 14 55638108 missense possibly damaging 0.74
R4633:Tm9sf1 UTSW 14 55641203 missense probably damaging 1.00
R4816:Tm9sf1 UTSW 14 55641149 missense possibly damaging 0.89
R4943:Tm9sf1 UTSW 14 55641168 missense probably damaging 0.99
R5270:Tm9sf1 UTSW 14 55636481 missense probably damaging 1.00
R5384:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5385:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5386:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5561:Tm9sf1 UTSW 14 55638097 missense probably damaging 1.00
R6246:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R6247:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R6248:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R7319:Tm9sf1 UTSW 14 55637975 unclassified probably benign
R7659:Tm9sf1 UTSW 14 55636335 missense probably damaging 1.00
R7974:Tm9sf1 UTSW 14 55636449 missense probably damaging 1.00
X0025:Tm9sf1 UTSW 14 55642836 missense probably benign 0.43
X0026:Tm9sf1 UTSW 14 55642937 start codon destroyed probably null 0.92
Predicted Primers PCR Primer
(F):5'- CAAAACCCTGCTGAATGCAAGGTG -3'
(R):5'- CTTCCTGACTTGGAGTGTGGTGAAC -3'

Sequencing Primer
(F):5'- tccacctgcctctacctc -3'
(R):5'- AGTGTGGTGAACTCAGTGC -3'
Posted On2013-07-11