Incidental Mutation 'R7733:Scn3a'
ID595959
Institutional Source Beutler Lab
Gene Symbol Scn3a
Ensembl Gene ENSMUSG00000057182
Gene Namesodium channel, voltage-gated, type III, alpha
SynonymsNav1.3, LOC381367
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7733 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location65457118-65567627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65508650 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 562 (I562F)
Ref Sequence ENSEMBL: ENSMUSP00000065023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066432] [ENSMUST00000100069]
Predicted Effect probably benign
Transcript: ENSMUST00000066432
AA Change: I562F

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000065023
Gene: ENSMUSG00000057182
AA Change: I562F

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100069
AA Change: I562F

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097647
Gene: ENSMUSG00000057182
AA Change: I562F

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality of most mutants by weaning. Heterozygous mice exhibit improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik T A 6: 133,294,277 S95T probably benign Het
9530053A07Rik A T 7: 28,139,965 D401V probably damaging Het
Abca8a A G 11: 110,054,587 F1070L probably benign Het
Acsl3 G C 1: 78,688,236 probably null Het
Adarb2 T A 13: 8,752,608 S640T possibly damaging Het
Adgre5 T C 8: 83,729,396 D257G probably benign Het
Adora2b A T 11: 62,265,339 I205F possibly damaging Het
Asb14 A G 14: 26,912,352 M505V probably benign Het
Atrnl1 T C 19: 57,701,988 V876A probably benign Het
AU040320 A G 4: 126,835,529 N495D possibly damaging Het
BC005561 T C 5: 104,519,960 F783L possibly damaging Het
Bcam A T 7: 19,760,388 V361E probably benign Het
Cbwd1 T C 19: 24,940,794 D204G probably damaging Het
Ccdc7a T A 8: 128,993,052 E247V probably damaging Het
Cd84 T A 1: 171,840,659 M1K probably null Het
Cfap43 C T 19: 47,897,993 R61H possibly damaging Het
Clec4a1 A G 6: 122,932,150 D159G possibly damaging Het
Ctcfl C T 2: 173,117,192 R247Q probably benign Het
Ctdnep1 G A 11: 69,990,009 R236Q probably damaging Het
Cwf19l2 A T 9: 3,450,066 H589L probably benign Het
Cyp2u1 G T 3: 131,303,027 A34E probably benign Het
Cyp4x1 A G 4: 115,120,194 S281P possibly damaging Het
Dag1 T C 9: 108,208,848 T365A probably benign Het
Dhx57 A T 17: 80,265,074 probably null Het
Dnajb1 T G 8: 83,608,377 S16A probably benign Het
Dsc2 A T 18: 20,048,315 L145Q probably benign Het
Dsc2 G C 18: 20,048,316 L145V probably benign Het
Eefsec T C 6: 88,376,220 T156A possibly damaging Het
Eif6 T A 2: 155,823,232 D169V probably benign Het
Ell3 C A 2: 121,442,520 G3V possibly damaging Het
Eprs A T 1: 185,397,161 H615L probably benign Het
Fbxw10 A G 11: 62,873,397 Y630C unknown Het
G6pc2 C T 2: 69,220,183 Q51* probably null Het
Glt8d1 C T 14: 31,001,978 probably benign Het
Gm16486 A G 8: 70,717,451 T1397A possibly damaging Het
Gpr4 T C 7: 19,222,710 Y186H probably damaging Het
Grhpr T C 4: 44,981,494 probably benign Het
Gsdma3 A G 11: 98,635,215 H264R probably damaging Het
Hcfc2 A G 10: 82,739,179 Y224C probably benign Het
Helz2 A G 2: 181,230,355 F2608S possibly damaging Het
Herc2 C T 7: 56,188,664 T3313M probably damaging Het
Hmgcl A T 4: 135,960,083 H223L probably benign Het
Igf2r A G 17: 12,739,369 V139A possibly damaging Het
Kif5a T A 10: 127,236,740 T727S probably benign Het
Kifc1 G A 17: 33,883,569 R357W probably damaging Het
Krt81 T A 15: 101,463,514 S62C probably damaging Het
Lgi2 T C 5: 52,538,531 N362S probably benign Het
Lig1 G T 7: 13,296,231 R378L possibly damaging Het
Map3k13 C T 16: 21,921,686 R588C probably damaging Het
Mov10l1 T A 15: 89,024,801 F1008L probably damaging Het
Nr4a2 A G 2: 57,112,321 V40A probably benign Het
Nrde2 A T 12: 100,144,140 C206S possibly damaging Het
Olfr1316 C T 2: 112,130,041 V257I probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Pcdhb12 A G 18: 37,437,036 T412A probably damaging Het
Plekhh2 T A 17: 84,583,524 Y839* probably null Het
Pnpla6 T A 8: 3,522,660 F316I probably benign Het
Prcp C T 7: 92,901,298 T101M probably damaging Het
Prex2 G T 1: 11,181,959 R1076L probably benign Het
Prpf40b T C 15: 99,308,343 probably null Het
Psd3 T G 8: 68,120,916 K204N possibly damaging Het
Ptpro C A 6: 137,414,286 C801* probably null Het
Ptprt A G 2: 161,575,787 V923A probably damaging Het
Ptprz1 T A 6: 23,000,384 D824E probably benign Het
Rasgrf1 A G 9: 89,981,727 D582G probably benign Het
Rfc2 T C 5: 134,593,216 L183P probably damaging Het
Rnf114 T C 2: 167,512,518 V173A probably damaging Het
Setmar T C 6: 108,076,127 I194T probably damaging Het
Sptb A T 12: 76,597,921 probably null Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sptlc3 G T 2: 139,631,368 M512I possibly damaging Het
Svep1 C A 4: 58,049,239 A3423S probably benign Het
Sycp1 T C 3: 102,895,962 T511A probably benign Het
Synm T A 7: 67,735,945 probably null Het
Tada1 C T 1: 166,389,942 P216L probably damaging Het
Tas2r117 T A 6: 132,803,175 M92K probably benign Het
Thsd1 T C 8: 22,258,721 L536P probably damaging Het
Timp2 T G 11: 118,317,529 probably null Het
Trak1 T A 9: 121,367,225 V41D possibly damaging Het
Ubqln3 T A 7: 104,141,076 L602F probably damaging Het
Vmn2r59 A G 7: 42,012,019 F791L probably benign Het
Wbp4 A G 14: 79,477,040 probably null Het
Other mutations in Scn3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Scn3a APN 2 65497392 missense probably benign 0.05
IGL01086:Scn3a APN 2 65470159 missense probably benign 0.27
IGL01141:Scn3a APN 2 65495113 missense possibly damaging 0.73
IGL01150:Scn3a APN 2 65497365 splice site probably null
IGL01564:Scn3a APN 2 65461446 missense probably damaging 1.00
IGL01594:Scn3a APN 2 65461431 missense probably damaging 1.00
IGL01751:Scn3a APN 2 65461252 missense possibly damaging 0.87
IGL01803:Scn3a APN 2 65521783 unclassified probably benign
IGL01822:Scn3a APN 2 65495264 missense probably damaging 1.00
IGL02063:Scn3a APN 2 65461510 missense probably damaging 1.00
IGL02142:Scn3a APN 2 65526621 missense possibly damaging 0.95
IGL02198:Scn3a APN 2 65508489 missense probably benign 0.12
IGL02501:Scn3a APN 2 65526555 missense possibly damaging 0.82
IGL02608:Scn3a APN 2 65524166 nonsense probably null
IGL02645:Scn3a APN 2 65514527 missense probably benign 0.12
IGL02653:Scn3a APN 2 65461187 missense probably damaging 1.00
IGL03077:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03099:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03299:Scn3a APN 2 65497516 missense probably benign 0.01
IGL03327:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03346:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03355:Scn3a APN 2 65460568 missense possibly damaging 0.91
curtsey UTSW 2 65464836 missense probably damaging 1.00
dip UTSW 2 65524179 missense probably benign 0.01
Regime UTSW 2 65524850 missense possibly damaging 0.93
Willpower UTSW 2 65525754 missense possibly damaging 0.92
R0019:Scn3a UTSW 2 65461701 missense probably damaging 1.00
R0316:Scn3a UTSW 2 65460829 missense probably damaging 1.00
R0374:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R0414:Scn3a UTSW 2 65525982 splice site probably benign
R0609:Scn3a UTSW 2 65536510 missense probably damaging 0.96
R0613:Scn3a UTSW 2 65472284 missense possibly damaging 0.92
R0645:Scn3a UTSW 2 65524850 missense possibly damaging 0.93
R0665:Scn3a UTSW 2 65484411 missense probably null 0.00
R0667:Scn3a UTSW 2 65484411 missense probably null 0.00
R0710:Scn3a UTSW 2 65469046 missense probably damaging 0.99
R1202:Scn3a UTSW 2 65506147 missense probably benign 0.07
R1440:Scn3a UTSW 2 65529441 missense possibly damaging 0.95
R1447:Scn3a UTSW 2 65469980 missense probably damaging 1.00
R1564:Scn3a UTSW 2 65514635 missense probably damaging 0.98
R1595:Scn3a UTSW 2 65498979 missense probably damaging 0.99
R1775:Scn3a UTSW 2 65472342 missense probably damaging 1.00
R1781:Scn3a UTSW 2 65472385 missense probably damaging 1.00
R1822:Scn3a UTSW 2 65484372 missense probably damaging 1.00
R1924:Scn3a UTSW 2 65461534 missense probably damaging 1.00
R2061:Scn3a UTSW 2 65461308 missense probably damaging 1.00
R2070:Scn3a UTSW 2 65520866 missense possibly damaging 0.72
R2174:Scn3a UTSW 2 65507206 missense probably damaging 0.99
R2656:Scn3a UTSW 2 65526518 missense probably damaging 0.99
R2680:Scn3a UTSW 2 65536536 missense probably benign 0.04
R3882:Scn3a UTSW 2 65482279 missense probably benign 0.03
R4019:Scn3a UTSW 2 65525951 intron probably benign
R4106:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4108:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4109:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4225:Scn3a UTSW 2 65536427 missense probably damaging 0.99
R4419:Scn3a UTSW 2 65466960 missense probably damaging 1.00
R4552:Scn3a UTSW 2 65524179 missense probably benign 0.01
R4687:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R4780:Scn3a UTSW 2 65506193 missense probably damaging 1.00
R4820:Scn3a UTSW 2 65461278 missense probably damaging 1.00
R4856:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4886:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4914:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4915:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4918:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R5088:Scn3a UTSW 2 65472299 missense probably damaging 1.00
R5101:Scn3a UTSW 2 65461506 missense probably damaging 1.00
R5128:Scn3a UTSW 2 65508518 missense probably benign 0.08
R5132:Scn3a UTSW 2 65468204 missense probably benign 0.09
R5297:Scn3a UTSW 2 65469034 missense possibly damaging 0.83
R5595:Scn3a UTSW 2 65460713 missense probably benign
R5699:Scn3a UTSW 2 65507264 missense possibly damaging 0.54
R5730:Scn3a UTSW 2 65495260 missense probably benign 0.00
R5735:Scn3a UTSW 2 65482278 missense probably damaging 0.98
R5735:Scn3a UTSW 2 65484459 missense probably benign 0.09
R5855:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R5888:Scn3a UTSW 2 65497398 missense probably benign 0.06
R5898:Scn3a UTSW 2 65514695 missense probably damaging 0.96
R5935:Scn3a UTSW 2 65464836 missense probably damaging 1.00
R5970:Scn3a UTSW 2 65494781 intron probably benign
R6214:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6215:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6235:Scn3a UTSW 2 65461335 missense probably damaging 0.97
R6307:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R6355:Scn3a UTSW 2 65461299 missense probably damaging 0.99
R6376:Scn3a UTSW 2 65461499 missense possibly damaging 0.88
R6517:Scn3a UTSW 2 65497563 missense possibly damaging 0.73
R6775:Scn3a UTSW 2 65521815 missense possibly damaging 0.82
R6893:Scn3a UTSW 2 65525754 missense possibly damaging 0.92
R6986:Scn3a UTSW 2 65508618 missense probably damaging 0.97
R7065:Scn3a UTSW 2 65464855 missense probably benign
R7078:Scn3a UTSW 2 65497600 missense probably damaging 1.00
R7146:Scn3a UTSW 2 65483142 missense probably damaging 1.00
R7240:Scn3a UTSW 2 65469042 missense possibly damaging 0.77
R7294:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R7352:Scn3a UTSW 2 65525701 missense possibly damaging 0.51
R7636:Scn3a UTSW 2 65497689 missense probably damaging 1.00
R7708:Scn3a UTSW 2 65483168 missense possibly damaging 0.47
R7761:Scn3a UTSW 2 65529454 missense possibly damaging 0.95
R7792:Scn3a UTSW 2 65466990 nonsense probably null
R7828:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R7875:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7884:Scn3a UTSW 2 65536515 missense probably damaging 0.96
R7958:Scn3a UTSW 2 65506193 missense probably damaging 1.00
R7965:Scn3a UTSW 2 65506211 missense probably damaging 1.00
R8171:Scn3a UTSW 2 65530810 missense possibly damaging 0.85
R8345:Scn3a UTSW 2 65498991 missense possibly damaging 0.86
R8356:Scn3a UTSW 2 65460673 missense probably benign 0.08
R8456:Scn3a UTSW 2 65460673 missense probably benign 0.08
R8527:Scn3a UTSW 2 65497519 missense probably damaging 0.99
R8688:Scn3a UTSW 2 65525703 missense possibly damaging 0.92
R8731:Scn3a UTSW 2 65468163 nonsense probably null
X0062:Scn3a UTSW 2 65467001 missense probably damaging 0.98
X0062:Scn3a UTSW 2 65524847 nonsense probably null
Z1177:Scn3a UTSW 2 65498892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAACGTTACTGTTGCGTCG -3'
(R):5'- TCCTGACATTTGCACTGTGG -3'

Sequencing Primer
(F):5'- GTCGCTCTCCAGGTCTGTG -3'
(R):5'- GCACTGTGGCCTTCAATATATAAAAG -3'
Posted On2019-11-12