Incidental Mutation 'R7733:G6pc2'
ID595960
Institutional Source Beutler Lab
Gene Symbol G6pc2
Ensembl Gene ENSMUSG00000005232
Gene Nameglucose-6-phosphatase, catalytic, 2
SynonymsIGRP, G6pc-rs, islet specific glucose-6-phosphatase
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7733 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location69211073-69227841 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 69220183 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 51 (Q51*)
Ref Sequence ENSEMBL: ENSMUSP00000005364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005364] [ENSMUST00000112317]
Predicted Effect probably null
Transcript: ENSMUST00000005364
AA Change: Q51*
SMART Domains Protein: ENSMUSP00000005364
Gene: ENSMUSG00000005232
AA Change: Q51*

DomainStartEndE-ValueType
acidPPc 53 194 7.83e-21 SMART
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 254 273 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112317
AA Change: Q51*
SMART Domains Protein: ENSMUSP00000107936
Gene: ENSMUSG00000005232
AA Change: Q51*

DomainStartEndE-ValueType
SCOP:d1d2ta_ 6 126 5e-13 SMART
Blast:acidPPc 53 147 1e-65 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that belongs to the glucose-6-phosphatase catalytic subunit family. Members of this family catalyze the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, to release glucose into the bloodstream. The family member encoded by this gene is found specifically in pancreatic islets but has not been shown to have phosphotransferase or phosphatase activity exhibited by a similar liver enzyme. The non-obese diabetic (NOD) mouse is a model for human type 1 diabetes, an autoimmune disease in which T lymphocytes attack and destroy insulin-producing pancreatic beta cells. In NOD mice, the protein encoded by this gene is a major target of cell-mediated autoimmunity. Variations in the human and mouse genes are associated with lower fasting plasma glucose levels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a disruption of this gene show a significant drop in fasting blood glucose. Females also show a significant drop in plasma triacylglycerol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik T A 6: 133,294,277 S95T probably benign Het
9530053A07Rik A T 7: 28,139,965 D401V probably damaging Het
Abca8a A G 11: 110,054,587 F1070L probably benign Het
Acsl3 G C 1: 78,688,236 probably null Het
Adarb2 T A 13: 8,752,608 S640T possibly damaging Het
Adgre5 T C 8: 83,729,396 D257G probably benign Het
Adora2b A T 11: 62,265,339 I205F possibly damaging Het
Asb14 A G 14: 26,912,352 M505V probably benign Het
Atrnl1 T C 19: 57,701,988 V876A probably benign Het
AU040320 A G 4: 126,835,529 N495D possibly damaging Het
BC005561 T C 5: 104,519,960 F783L possibly damaging Het
Bcam A T 7: 19,760,388 V361E probably benign Het
Cbwd1 T C 19: 24,940,794 D204G probably damaging Het
Ccdc7a T A 8: 128,993,052 E247V probably damaging Het
Cd84 T A 1: 171,840,659 M1K probably null Het
Cfap43 C T 19: 47,897,993 R61H possibly damaging Het
Clec4a1 A G 6: 122,932,150 D159G possibly damaging Het
Ctcfl C T 2: 173,117,192 R247Q probably benign Het
Ctdnep1 G A 11: 69,990,009 R236Q probably damaging Het
Cwf19l2 A T 9: 3,450,066 H589L probably benign Het
Cyp2u1 G T 3: 131,303,027 A34E probably benign Het
Cyp4x1 A G 4: 115,120,194 S281P possibly damaging Het
Dag1 T C 9: 108,208,848 T365A probably benign Het
Dhx57 A T 17: 80,265,074 probably null Het
Dnajb1 T G 8: 83,608,377 S16A probably benign Het
Dsc2 A T 18: 20,048,315 L145Q probably benign Het
Dsc2 G C 18: 20,048,316 L145V probably benign Het
Eefsec T C 6: 88,376,220 T156A possibly damaging Het
Eif6 T A 2: 155,823,232 D169V probably benign Het
Ell3 C A 2: 121,442,520 G3V possibly damaging Het
Eprs A T 1: 185,397,161 H615L probably benign Het
Fbxw10 A G 11: 62,873,397 Y630C unknown Het
Glt8d1 C T 14: 31,001,978 probably benign Het
Gm16486 A G 8: 70,717,451 T1397A possibly damaging Het
Gpr4 T C 7: 19,222,710 Y186H probably damaging Het
Grhpr T C 4: 44,981,494 probably benign Het
Gsdma3 A G 11: 98,635,215 H264R probably damaging Het
Hcfc2 A G 10: 82,739,179 Y224C probably benign Het
Helz2 A G 2: 181,230,355 F2608S possibly damaging Het
Herc2 C T 7: 56,188,664 T3313M probably damaging Het
Hmgcl A T 4: 135,960,083 H223L probably benign Het
Igf2r A G 17: 12,739,369 V139A possibly damaging Het
Kif5a T A 10: 127,236,740 T727S probably benign Het
Kifc1 G A 17: 33,883,569 R357W probably damaging Het
Krt81 T A 15: 101,463,514 S62C probably damaging Het
Lgi2 T C 5: 52,538,531 N362S probably benign Het
Lig1 G T 7: 13,296,231 R378L possibly damaging Het
Map3k13 C T 16: 21,921,686 R588C probably damaging Het
Mov10l1 T A 15: 89,024,801 F1008L probably damaging Het
Nr4a2 A G 2: 57,112,321 V40A probably benign Het
Nrde2 A T 12: 100,144,140 C206S possibly damaging Het
Olfr1316 C T 2: 112,130,041 V257I probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Pcdhb12 A G 18: 37,437,036 T412A probably damaging Het
Plekhh2 T A 17: 84,583,524 Y839* probably null Het
Pnpla6 T A 8: 3,522,660 F316I probably benign Het
Prcp C T 7: 92,901,298 T101M probably damaging Het
Prex2 G T 1: 11,181,959 R1076L probably benign Het
Prpf40b T C 15: 99,308,343 probably null Het
Psd3 T G 8: 68,120,916 K204N possibly damaging Het
Ptpro C A 6: 137,414,286 C801* probably null Het
Ptprt A G 2: 161,575,787 V923A probably damaging Het
Ptprz1 T A 6: 23,000,384 D824E probably benign Het
Rasgrf1 A G 9: 89,981,727 D582G probably benign Het
Rfc2 T C 5: 134,593,216 L183P probably damaging Het
Rnf114 T C 2: 167,512,518 V173A probably damaging Het
Scn3a T A 2: 65,508,650 I562F probably benign Het
Setmar T C 6: 108,076,127 I194T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sptlc3 G T 2: 139,631,368 M512I possibly damaging Het
Svep1 C A 4: 58,049,239 A3423S probably benign Het
Sycp1 T C 3: 102,895,962 T511A probably benign Het
Tada1 C T 1: 166,389,942 P216L probably damaging Het
Tas2r117 T A 6: 132,803,175 M92K probably benign Het
Thsd1 T C 8: 22,258,721 L536P probably damaging Het
Timp2 T G 11: 118,317,529 probably null Het
Ubqln3 T A 7: 104,141,076 L602F probably damaging Het
Vmn2r59 A G 7: 42,012,019 F791L probably benign Het
Wbp4 A G 14: 79,477,040 probably null Het
Other mutations in G6pc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:G6pc2 APN 2 69222967 missense probably damaging 1.00
IGL02031:G6pc2 APN 2 69222991 missense probably benign 0.36
IGL02504:G6pc2 APN 2 69226595 missense probably damaging 0.99
IGL02674:G6pc2 APN 2 69226566 critical splice acceptor site probably null
IGL03339:G6pc2 APN 2 69220895 splice site probably benign
R0011:G6pc2 UTSW 2 69226565 splice site probably benign
R1113:G6pc2 UTSW 2 69220226 missense probably damaging 1.00
R1308:G6pc2 UTSW 2 69220226 missense probably damaging 1.00
R1417:G6pc2 UTSW 2 69222968 missense probably damaging 1.00
R1441:G6pc2 UTSW 2 69220854 missense probably damaging 0.97
R1658:G6pc2 UTSW 2 69227069 missense probably damaging 1.00
R1762:G6pc2 UTSW 2 69220842 missense possibly damaging 0.53
R1768:G6pc2 UTSW 2 69222977 missense probably damaging 1.00
R3161:G6pc2 UTSW 2 69220112 missense probably damaging 0.98
R5487:G6pc2 UTSW 2 69226577 missense probably damaging 0.99
R5623:G6pc2 UTSW 2 69226583 missense probably damaging 1.00
R5686:G6pc2 UTSW 2 69220784 missense probably benign 0.03
R7493:G6pc2 UTSW 2 69223000 missense probably benign 0.00
X0040:G6pc2 UTSW 2 69223010 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GTCACGTAATGGCTCAGTGC -3'
(R):5'- TTGGAAGATTTCTGTGTCGAAGTAC -3'

Sequencing Primer
(F):5'- CGTAATGGCTCAGTGCATCAC -3'
(R):5'- TGTGTCGAAGTACATGCACC -3'
Posted On2019-11-12