Incidental Mutation 'R7733:Ptprt'
ID 595965
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
MMRRC Submission 045789-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R7733 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 161417707 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 923 (V923A)
Ref Sequence ENSEMBL: ENSMUSP00000105067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: V923A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: V923A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: V942A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: V942A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: V933A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: V933A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: V923A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: V923A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik T A 6: 133,271,240 (GRCm39) S95T probably benign Het
Abca8a A G 11: 109,945,413 (GRCm39) F1070L probably benign Het
Acsl3 G C 1: 78,665,953 (GRCm39) probably null Het
Adarb2 T A 13: 8,802,644 (GRCm39) S640T possibly damaging Het
Adgre5 T C 8: 84,456,025 (GRCm39) D257G probably benign Het
Adora2b A T 11: 62,156,165 (GRCm39) I205F possibly damaging Het
Asb14 A G 14: 26,634,309 (GRCm39) M505V probably benign Het
Atrnl1 T C 19: 57,690,420 (GRCm39) V876A probably benign Het
AU040320 A G 4: 126,729,322 (GRCm39) N495D possibly damaging Het
Bcam A T 7: 19,494,313 (GRCm39) V361E probably benign Het
Ccdc7a T A 8: 129,719,533 (GRCm39) E247V probably damaging Het
Cd84 T A 1: 171,668,226 (GRCm39) M1K probably null Het
Cfap43 C T 19: 47,886,432 (GRCm39) R61H possibly damaging Het
Clec4a1 A G 6: 122,909,109 (GRCm39) D159G possibly damaging Het
Ctcfl C T 2: 172,958,985 (GRCm39) R247Q probably benign Het
Ctdnep1 G A 11: 69,880,835 (GRCm39) R236Q probably damaging Het
Cwf19l2 A T 9: 3,450,066 (GRCm39) H589L probably benign Het
Cyp2u1 G T 3: 131,096,676 (GRCm39) A34E probably benign Het
Cyp4x1 A G 4: 114,977,391 (GRCm39) S281P possibly damaging Het
Dag1 T C 9: 108,086,047 (GRCm39) T365A probably benign Het
Dhx57 A T 17: 80,572,503 (GRCm39) probably null Het
Dnajb1 T G 8: 84,335,006 (GRCm39) S16A probably benign Het
Dsc2 A T 18: 20,181,372 (GRCm39) L145Q probably benign Het
Dsc2 G C 18: 20,181,373 (GRCm39) L145V probably benign Het
Eefsec T C 6: 88,353,202 (GRCm39) T156A possibly damaging Het
Eif6 T A 2: 155,665,152 (GRCm39) D169V probably benign Het
Ell3 C A 2: 121,273,001 (GRCm39) G3V possibly damaging Het
Eprs1 A T 1: 185,129,358 (GRCm39) H615L probably benign Het
Fbxw10 A G 11: 62,764,223 (GRCm39) Y630C unknown Het
Fcgbpl1 A T 7: 27,839,390 (GRCm39) D401V probably damaging Het
G6pc2 C T 2: 69,050,527 (GRCm39) Q51* probably null Het
Glt8d1 C T 14: 30,723,935 (GRCm39) probably benign Het
Gpr4 T C 7: 18,956,635 (GRCm39) Y186H probably damaging Het
Grhpr T C 4: 44,981,494 (GRCm39) probably benign Het
Gsdma3 A G 11: 98,526,041 (GRCm39) H264R probably damaging Het
Hcfc2 A G 10: 82,575,013 (GRCm39) Y224C probably benign Het
Helz2 A G 2: 180,872,148 (GRCm39) F2608S possibly damaging Het
Herc2 C T 7: 55,838,412 (GRCm39) T3313M probably damaging Het
Hmgcl A T 4: 135,687,394 (GRCm39) H223L probably benign Het
Igf2r A G 17: 12,958,256 (GRCm39) V139A possibly damaging Het
Iqcn A G 8: 71,170,100 (GRCm39) T1397A possibly damaging Het
Kif5a T A 10: 127,072,609 (GRCm39) T727S probably benign Het
Kifc1 G A 17: 34,102,543 (GRCm39) R357W probably damaging Het
Krt81 T A 15: 101,361,395 (GRCm39) S62C probably damaging Het
Lgi2 T C 5: 52,695,873 (GRCm39) N362S probably benign Het
Lig1 G T 7: 13,030,157 (GRCm39) R378L possibly damaging Het
Map3k13 C T 16: 21,740,436 (GRCm39) R588C probably damaging Het
Mov10l1 T A 15: 88,909,004 (GRCm39) F1008L probably damaging Het
Nr4a2 A G 2: 57,002,333 (GRCm39) V40A probably benign Het
Nrde2 A T 12: 100,110,399 (GRCm39) C206S possibly damaging Het
Or4f14d C T 2: 111,960,386 (GRCm39) V257I probably benign Het
Parp1 T C 1: 180,427,777 (GRCm39) probably null Het
Pcdhb12 A G 18: 37,570,089 (GRCm39) T412A probably damaging Het
Plekhh2 T A 17: 84,890,952 (GRCm39) Y839* probably null Het
Pnpla6 T A 8: 3,572,660 (GRCm39) F316I probably benign Het
Prcp C T 7: 92,550,506 (GRCm39) T101M probably damaging Het
Prex2 G T 1: 11,252,183 (GRCm39) R1076L probably benign Het
Prpf40b T C 15: 99,206,224 (GRCm39) probably null Het
Psd3 T G 8: 68,573,568 (GRCm39) K204N possibly damaging Het
Ptpro C A 6: 137,391,284 (GRCm39) C801* probably null Het
Ptprz1 T A 6: 23,000,383 (GRCm39) D824E probably benign Het
Rasgrf1 A G 9: 89,863,780 (GRCm39) D582G probably benign Het
Rfc2 T C 5: 134,622,070 (GRCm39) L183P probably damaging Het
Rnf114 T C 2: 167,354,438 (GRCm39) V173A probably damaging Het
Scn3a T A 2: 65,338,994 (GRCm39) I562F probably benign Het
Setmar T C 6: 108,053,088 (GRCm39) I194T probably damaging Het
Sptb A T 12: 76,644,695 (GRCm39) probably null Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Sptlc3 G T 2: 139,473,288 (GRCm39) M512I possibly damaging Het
Svep1 C A 4: 58,049,239 (GRCm39) A3423S probably benign Het
Sycp1 T C 3: 102,803,278 (GRCm39) T511A probably benign Het
Synm T A 7: 67,385,693 (GRCm39) probably null Het
Tada1 C T 1: 166,217,511 (GRCm39) P216L probably damaging Het
Tas2r117 T A 6: 132,780,138 (GRCm39) M92K probably benign Het
Thoc2l T C 5: 104,667,826 (GRCm39) F783L possibly damaging Het
Thsd1 T C 8: 22,748,737 (GRCm39) L536P probably damaging Het
Timp2 T G 11: 118,208,355 (GRCm39) probably null Het
Trak1 T A 9: 121,196,291 (GRCm39) V41D possibly damaging Het
Ubqln3 T A 7: 103,790,283 (GRCm39) L602F probably damaging Het
Vmn2r59 A G 7: 41,661,443 (GRCm39) F791L probably benign Het
Wbp4 A G 14: 79,714,480 (GRCm39) probably null Het
Zng1 T C 19: 24,918,158 (GRCm39) D204G probably damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,769,692 (GRCm39) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,769,404 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,652,469 (GRCm39) critical splice donor site probably null
R1939:Ptprt UTSW 2 161,769,560 (GRCm39) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,608,241 (GRCm39) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,653,908 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,406,609 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,402,159 (GRCm39) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,120,143 (GRCm39) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,372,367 (GRCm39) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,449,225 (GRCm39) missense possibly damaging 0.88
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,372,361 (GRCm39) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACTTCGCAGACAGACAC -3'
(R):5'- GACCTGTTACCTCTCAGCAC -3'

Sequencing Primer
(F):5'- GGGATAAATACACCCCTTTGGACATG -3'
(R):5'- AGCACCTCTACTTCCTGATCTGTAG -3'
Posted On 2019-11-12