Incidental Mutation 'R7733:Ptprt'
ID595965
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Nameprotein tyrosine phosphatase, receptor type, T
SynonymsRPTPrho
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7733 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location161521990-162661147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 161575787 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 923 (V923A)
Ref Sequence ENSEMBL: ENSMUSP00000105067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: V923A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: V923A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: V942A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: V942A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: V933A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: V933A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: V923A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: V923A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik T A 6: 133,294,277 S95T probably benign Het
9530053A07Rik A T 7: 28,139,965 D401V probably damaging Het
Abca8a A G 11: 110,054,587 F1070L probably benign Het
Acsl3 G C 1: 78,688,236 probably null Het
Adarb2 T A 13: 8,752,608 S640T possibly damaging Het
Adgre5 T C 8: 83,729,396 D257G probably benign Het
Adora2b A T 11: 62,265,339 I205F possibly damaging Het
Asb14 A G 14: 26,912,352 M505V probably benign Het
Atrnl1 T C 19: 57,701,988 V876A probably benign Het
AU040320 A G 4: 126,835,529 N495D possibly damaging Het
BC005561 T C 5: 104,519,960 F783L possibly damaging Het
Bcam A T 7: 19,760,388 V361E probably benign Het
Cbwd1 T C 19: 24,940,794 D204G probably damaging Het
Ccdc7a T A 8: 128,993,052 E247V probably damaging Het
Cd84 T A 1: 171,840,659 M1K probably null Het
Cfap43 C T 19: 47,897,993 R61H possibly damaging Het
Clec4a1 A G 6: 122,932,150 D159G possibly damaging Het
Ctcfl C T 2: 173,117,192 R247Q probably benign Het
Ctdnep1 G A 11: 69,990,009 R236Q probably damaging Het
Cwf19l2 A T 9: 3,450,066 H589L probably benign Het
Cyp2u1 G T 3: 131,303,027 A34E probably benign Het
Cyp4x1 A G 4: 115,120,194 S281P possibly damaging Het
Dag1 T C 9: 108,208,848 T365A probably benign Het
Dhx57 A T 17: 80,265,074 probably null Het
Dnajb1 T G 8: 83,608,377 S16A probably benign Het
Dsc2 A T 18: 20,048,315 L145Q probably benign Het
Dsc2 G C 18: 20,048,316 L145V probably benign Het
Eefsec T C 6: 88,376,220 T156A possibly damaging Het
Eif6 T A 2: 155,823,232 D169V probably benign Het
Ell3 C A 2: 121,442,520 G3V possibly damaging Het
Eprs A T 1: 185,397,161 H615L probably benign Het
Fbxw10 A G 11: 62,873,397 Y630C unknown Het
G6pc2 C T 2: 69,220,183 Q51* probably null Het
Glt8d1 C T 14: 31,001,978 probably benign Het
Gm16486 A G 8: 70,717,451 T1397A possibly damaging Het
Gpr4 T C 7: 19,222,710 Y186H probably damaging Het
Grhpr T C 4: 44,981,494 probably benign Het
Gsdma3 A G 11: 98,635,215 H264R probably damaging Het
Hcfc2 A G 10: 82,739,179 Y224C probably benign Het
Helz2 A G 2: 181,230,355 F2608S possibly damaging Het
Herc2 C T 7: 56,188,664 T3313M probably damaging Het
Hmgcl A T 4: 135,960,083 H223L probably benign Het
Igf2r A G 17: 12,739,369 V139A possibly damaging Het
Kif5a T A 10: 127,236,740 T727S probably benign Het
Kifc1 G A 17: 33,883,569 R357W probably damaging Het
Krt81 T A 15: 101,463,514 S62C probably damaging Het
Lgi2 T C 5: 52,538,531 N362S probably benign Het
Lig1 G T 7: 13,296,231 R378L possibly damaging Het
Map3k13 C T 16: 21,921,686 R588C probably damaging Het
Mov10l1 T A 15: 89,024,801 F1008L probably damaging Het
Nr4a2 A G 2: 57,112,321 V40A probably benign Het
Nrde2 A T 12: 100,144,140 C206S possibly damaging Het
Olfr1316 C T 2: 112,130,041 V257I probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Pcdhb12 A G 18: 37,437,036 T412A probably damaging Het
Plekhh2 T A 17: 84,583,524 Y839* probably null Het
Pnpla6 T A 8: 3,522,660 F316I probably benign Het
Prcp C T 7: 92,901,298 T101M probably damaging Het
Prex2 G T 1: 11,181,959 R1076L probably benign Het
Prpf40b T C 15: 99,308,343 probably null Het
Psd3 T G 8: 68,120,916 K204N possibly damaging Het
Ptpro C A 6: 137,414,286 C801* probably null Het
Ptprz1 T A 6: 23,000,384 D824E probably benign Het
Rasgrf1 A G 9: 89,981,727 D582G probably benign Het
Rfc2 T C 5: 134,593,216 L183P probably damaging Het
Rnf114 T C 2: 167,512,518 V173A probably damaging Het
Scn3a T A 2: 65,508,650 I562F probably benign Het
Setmar T C 6: 108,076,127 I194T probably damaging Het
Sptb A T 12: 76,597,921 probably null Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sptlc3 G T 2: 139,631,368 M512I possibly damaging Het
Svep1 C A 4: 58,049,239 A3423S probably benign Het
Sycp1 T C 3: 102,895,962 T511A probably benign Het
Synm T A 7: 67,735,945 probably null Het
Tada1 C T 1: 166,389,942 P216L probably damaging Het
Tas2r117 T A 6: 132,803,175 M92K probably benign Het
Thsd1 T C 8: 22,258,721 L536P probably damaging Het
Timp2 T G 11: 118,317,529 probably null Het
Trak1 T A 9: 121,367,225 V41D possibly damaging Het
Ubqln3 T A 7: 104,141,076 L602F probably damaging Het
Vmn2r59 A G 7: 42,012,019 F791L probably benign Het
Wbp4 A G 14: 79,477,040 probably null Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161810624 missense probably benign 0.00
IGL00565:Ptprt APN 2 161560191 missense probably damaging 1.00
IGL00925:Ptprt APN 2 161656163 missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161551817 missense probably damaging 1.00
IGL01432:Ptprt APN 2 162268079 splice site probably benign
IGL02008:Ptprt APN 2 161927673 missense probably benign 0.02
IGL02040:Ptprt APN 2 162238072 missense probably damaging 1.00
IGL02172:Ptprt APN 2 161555502 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162238060 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162278046 critical splice donor site probably null
IGL02232:Ptprt APN 2 161530517 missense probably damaging 0.96
IGL02277:Ptprt APN 2 161547381 missense probably damaging 1.00
IGL02447:Ptprt APN 2 162278107 missense probably benign 0.01
IGL02601:Ptprt APN 2 161766307 missense probably benign 0.10
IGL02623:Ptprt APN 2 161607452 splice site probably benign
IGL03379:Ptprt APN 2 161555459 nonsense probably null
Poverina UTSW 2 161901497 missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161533613 missense probably damaging 0.96
R0064:Ptprt UTSW 2 161927791 splice site probably benign
R0129:Ptprt UTSW 2 162278070 missense probably benign 0.35
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0132:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0316:Ptprt UTSW 2 161607319 missense probably damaging 1.00
R0454:Ptprt UTSW 2 161553822 missense probably damaging 0.96
R0488:Ptprt UTSW 2 161553825 missense probably damaging 0.99
R0573:Ptprt UTSW 2 161551748 missense probably damaging 1.00
R0614:Ptprt UTSW 2 161812120 missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161812139 splice site probably null
R1023:Ptprt UTSW 2 161558943 missense probably damaging 1.00
R1184:Ptprt UTSW 2 161927772 missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162278226 missense probably damaging 1.00
R1476:Ptprt UTSW 2 161927484 missense probably damaging 1.00
R1515:Ptprt UTSW 2 162238034 missense probably damaging 1.00
R1595:Ptprt UTSW 2 161810549 critical splice donor site probably null
R1939:Ptprt UTSW 2 161927640 missense probably benign 0.45
R1987:Ptprt UTSW 2 161558898 missense probably damaging 1.00
R1987:Ptprt UTSW 2 161766321 missense possibly damaging 0.48
R2049:Ptprt UTSW 2 161534545 missense probably damaging 1.00
R2140:Ptprt UTSW 2 161811988 missense probably damaging 1.00
R2421:Ptprt UTSW 2 162278040 splice site probably benign
R3432:Ptprt UTSW 2 161927529 missense probably damaging 1.00
R3619:Ptprt UTSW 2 161566157 missense probably damaging 1.00
R3757:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3758:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3834:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3835:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3915:Ptprt UTSW 2 161555555 splice site probably benign
R4003:Ptprt UTSW 2 161566117 splice site probably benign
R4387:Ptprt UTSW 2 161927650 missense probably damaging 1.00
R4519:Ptprt UTSW 2 161564689 missense probably damaging 1.00
R4618:Ptprt UTSW 2 161553845 missense probably damaging 1.00
R4677:Ptprt UTSW 2 161901446 critical splice donor site probably null
R4866:Ptprt UTSW 2 161560239 missense probably damaging 1.00
R5088:Ptprt UTSW 2 162238175 missense probably benign 0.01
R5173:Ptprt UTSW 2 161927756 missense probably benign 0.01
R5215:Ptprt UTSW 2 162278164 missense probably damaging 1.00
R5383:Ptprt UTSW 2 161698049 missense probably damaging 1.00
R5398:Ptprt UTSW 2 161927592 missense probably damaging 1.00
R5518:Ptprt UTSW 2 162278223 missense probably damaging 0.99
R5711:Ptprt UTSW 2 161810604 missense probably damaging 0.98
R5735:Ptprt UTSW 2 161534564 missense probably damaging 0.98
R5834:Ptprt UTSW 2 161560269 missense probably damaging 1.00
R5872:Ptprt UTSW 2 162135218 missense probably damaging 1.00
R5926:Ptprt UTSW 2 161564686 missense probably benign 0.00
R6210:Ptprt UTSW 2 162268029 missense probably damaging 1.00
R6285:Ptprt UTSW 2 161901497 missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161553859 missense probably damaging 1.00
R6406:Ptprt UTSW 2 161553783 missense probably damaging 0.98
R6499:Ptprt UTSW 2 161534587 missense probably benign 0.32
R6613:Ptprt UTSW 2 161530447 missense probably damaging 1.00
R6622:Ptprt UTSW 2 161553840 missense probably damaging 1.00
R7218:Ptprt UTSW 2 161547364 missense probably damaging 1.00
R7247:Ptprt UTSW 2 161533523 missense probably benign 0.15
R7576:Ptprt UTSW 2 161607305 missense possibly damaging 0.88
R7735:Ptprt UTSW 2 161575741 missense probably damaging 1.00
R7813:Ptprt UTSW 2 161530493 missense probably damaging 1.00
R8031:Ptprt UTSW 2 162135457 missense probably damaging 1.00
R8074:Ptprt UTSW 2 161927661 missense possibly damaging 0.77
X0064:Ptprt UTSW 2 161927483 missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162238121 missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 161732887 missense probably damaging 1.00
Z1177:Ptprt UTSW 2 162362948 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ATGACTTCGCAGACAGACAC -3'
(R):5'- GACCTGTTACCTCTCAGCAC -3'

Sequencing Primer
(F):5'- GGGATAAATACACCCCTTTGGACATG -3'
(R):5'- AGCACCTCTACTTCCTGATCTGTAG -3'
Posted On2019-11-12