Mutagenetix > Incidental Mutation

Incidental Mutation 'R0242:Zc3h7b'

59598

Institutional Source

Beutler Lab

Gene Symbol

Zc3h7b

Ensembl Gene

ENSMUSG00000022390

Gene Name

zinc finger CCCH type containing 7B

Synonyms

Scrg3

MMRRC Submission

038480-MU

Accession Numbers

Genbank: NM_001081016; MGI: 1328310

Essential gene?

Probably non essential (E-score: 0.224) question?

Stock #

R0242 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

81745057-81796260 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 81768830 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000155100 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109554] [ENSMUST00000230946]

AlphaFold

F8VPP8

Predicted Effect

probably benign
Transcript: ENSMUST00000109554

SMART Domains

Protein: ENSMUSP00000105181
Gene: ENSMUSG00000022390

Domain	Start	End	E-Value	Type
Pfam:TPR_11	34	113	2.3e-12	PFAM
Pfam:TPR_1	82	115	2.4e-6	PFAM
Pfam:TPR_8	82	115	8.2e-4	PFAM
Pfam:TPR_8	116	143	4.8e-3	PFAM
low complexity region	294	309	N/A	INTRINSIC
low complexity region	340	354	N/A	INTRINSIC
ZnF_C3H1	482	508	2.15e1	SMART
ZnF_C3H1	612	638	2.03e1	SMART
ZnF_C3H1	757	782	8.31e0	SMART
ZnF_C2H2	843	867	2.86e-1	SMART
ZnF_C3H1	889	914	7.81e-1	SMART
low complexity region	959	981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229044

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230368

Predicted Effect

probably benign
Transcript: ENSMUST00000230946

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.5%

Validation Efficiency

97% (110/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a tetratricopeptide repeat domain. The encoded protein also interacts with the rotavirus non-structural protein NSP3. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(9) : Gene trapped(9)

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	T	C	8: 13,551,676	D230G	probably benign	Het
4930435E12Rik	C	T	16: 38,824,567		probably benign	Het
Abhd13	A	G	8: 9,987,561	I53V	probably benign	Het
Adgrl2	A	C	3: 148,839,185		probably null	Het
Aldh16a1	G	A	7: 45,144,664	A596V	probably damaging	Het
Aldh3b2	T	A	19: 3,979,414	Y262*	probably null	Het
Ambn	A	G	5: 88,467,972	Q420R	possibly damaging	Het
Ankib1	A	C	5: 3,700,344		probably benign	Het
Arhgap9	C	A	10: 127,329,538	H430Q	probably benign	Het
Arhgef25	C	T	10: 127,184,064	G435E	probably damaging	Het
Armc12	A	T	17: 28,532,392	D120V	possibly damaging	Het
Armc4	A	T	18: 7,211,516	V786D	probably damaging	Het
Asxl3	G	A	18: 22,516,681	E576K	possibly damaging	Het
Bcdin3d	T	C	15: 99,470,895	E141G	probably benign	Het
Bmpr1b	G	A	3: 141,840,676	T483M	probably damaging	Het
Caprin2	C	T	6: 148,842,954	S991N	probably damaging	Het
Cd96	T	C	16: 46,071,766	I286M	possibly damaging	Het
Cdcp1	G	T	9: 123,180,172	F480L	probably benign	Het
Celf5	T	C	10: 81,464,409	T258A	probably benign	Het
Cgnl1	A	G	9: 71,721,657	V577A	probably damaging	Het
Clca3b	A	G	3: 144,841,465	S304P	probably benign	Het
Cmya5	A	T	13: 93,095,600	H993Q	probably benign	Het
Cnbp	A	T	6: 87,845,764	C6S	probably damaging	Het
Col14a1	C	T	15: 55,497,511	R1605W	probably damaging	Het
Cops7a	T	C	6: 124,964,854	N11S	probably benign	Het
Coro7	T	C	16: 4,630,178		probably benign	Het
Cpvl	T	C	6: 53,932,500	H217R	possibly damaging	Het
Cuedc1	T	C	11: 88,184,621		probably benign	Het
Cyp2c66	A	G	19: 39,141,925	Y68C	probably damaging	Het
Dicer1	G	A	12: 104,702,451	T1324M	probably benign	Het
Dlgap2	A	G	8: 14,727,562	D268G	probably benign	Het
Dnm1	T	A	2: 32,316,989	M535L	possibly damaging	Het
Dock7	A	T	4: 98,962,280	F1575Y	probably benign	Het
Dpp10	T	A	1: 123,398,546	H403L	possibly damaging	Het
Dync1h1	A	G	12: 110,649,851	D3112G	possibly damaging	Het
Eno3	A	G	11: 70,657,935	E21G	probably null	Het
Fam120b	T	A	17: 15,422,924	V655D	probably damaging	Het
Fam129a	A	G	1: 151,718,216	D884G	probably benign	Het
Fkbp5	A	T	17: 28,428,452	D136E	probably benign	Het
Gdap1l1	T	A	2: 163,447,653	Y179*	probably null	Het
Gfer	A	G	17: 24,694,303	W192R	probably damaging	Het
Gm4782	A	G	6: 50,609,858	T408A	probably benign	Het
Golgb1	C	T	16: 36,875,630	Q164*	probably null	Het
Gpnmb	A	G	6: 49,047,342	N197S	probably damaging	Het
Gtf2f1	G	A	17: 57,003,802	T414M	probably benign	Het
Hc	A	G	2: 35,036,154		probably benign	Het
Hcfc1	A	T	X: 73,948,429		probably benign	Het
Helz2	C	T	2: 181,230,430	R2539Q	probably damaging	Het
Hsd17b12	T	A	2: 94,157,815	I19F	probably benign	Het
Incenp	T	C	19: 9,893,750	T172A	unknown	Het
Jmy	A	G	13: 93,441,618	Y681H	probably benign	Het
Kbtbd11	A	G	8: 15,027,508	T36A	probably benign	Het
Kcnh4	T	C	11: 100,755,699	D267G	probably damaging	Het
Krt34	C	T	11: 100,041,331	E56K	probably damaging	Het
Krt40	T	A	11: 99,538,742	E335D	probably damaging	Het
Krt86	T	A	15: 101,476,573	Y282*	probably null	Het
Lgi3	C	T	14: 70,534,815	R267*	probably null	Het
Lnpk	A	G	2: 74,537,289		probably benign	Het
Lrp1b	T	A	2: 40,998,183	H2355L	probably benign	Het
Lrrc8e	G	A	8: 4,235,401	R542H	probably benign	Het
Mia2	T	C	12: 59,108,856	Y452H	probably damaging	Het
Mmachc	C	T	4: 116,704,541	R132Q	probably damaging	Het
Mtbp	T	A	15: 55,577,486	N356K	possibly damaging	Het
Mum1	T	C	10: 80,234,258	S354P	probably benign	Het
Myo5b	A	G	18: 74,661,716	H552R	possibly damaging	Het
Noxred1	A	G	12: 87,226,979	V96A	probably benign	Het
Nr1d2	T	A	14: 18,211,933	D390V	possibly damaging	Het
Oas1e	A	T	5: 120,791,774		probably benign	Het
Olfr398	T	C	11: 73,983,712	S299G	probably benign	Het
Olfr786	T	A	10: 129,437,348	Y179N	probably damaging	Het
Otog	G	T	7: 46,267,381	C914F	probably damaging	Het
Pank2	G	T	2: 131,280,197	C214F	probably damaging	Het
Pcdhb1	T	A	18: 37,266,735	S580T	probably benign	Het
Pdia3	T	C	2: 121,414,111	S2P	probably damaging	Het
Peli1	G	T	11: 21,142,602	R83L	probably damaging	Het
Pla2g3	T	A	11: 3,491,935	C366*	probably null	Het
Pon3	T	A	6: 5,240,860	D107V	probably benign	Het
Ppip5k2	A	G	1: 97,741,091	C532R	probably damaging	Het
Prph	A	T	15: 99,055,727	D174V	probably damaging	Het
Psd3	A	G	8: 67,758,086	M270T	probably damaging	Het
Pum3	A	G	19: 27,422,755		probably benign	Het
Pus1	A	T	5: 110,779,798	H30Q	probably benign	Het
Rab7	A	T	6: 88,005,132	V87E	probably damaging	Het
Rbm5	A	T	9: 107,751,708		probably benign	Het
Reln	A	G	5: 21,942,597		probably null	Het
S1pr3	A	G	13: 51,418,902	T40A	probably benign	Het
Sdk1	T	A	5: 142,143,922		probably benign	Het
Senp7	T	A	16: 56,179,521	I853N	probably damaging	Het
Serpinb6c	T	A	13: 33,899,247		probably benign	Het
Shroom1	T	G	11: 53,465,485		probably null	Het
Slc24a3	T	C	2: 145,606,664	I376T	probably benign	Het
Slc46a1	T	C	11: 78,468,667	I375T	possibly damaging	Het
Slc4a9	T	C	18: 36,533,680	F527S	probably damaging	Het
Slc4a9	T	A	18: 36,541,233	I924N	probably damaging	Het
Slx4	T	A	16: 3,986,952	E666V	probably damaging	Het
Snrnp27	G	A	6: 86,675,593		probably benign	Het
Sorcs1	C	T	19: 50,228,221	G640E	probably damaging	Het
Sptan1	A	T	2: 30,018,401	M1725L	probably benign	Het
Sync	G	A	4: 129,293,721	R182K	probably damaging	Het
Syne2	G	A	12: 76,098,034	G1586S	probably damaging	Het
Sytl1	G	T	4: 133,253,457	T522K	probably damaging	Het
Tex2	T	A	11: 106,519,955	K414*	probably null	Het
Thegl	G	T	5: 77,016,305	E52*	probably null	Het
Thsd7a	G	A	6: 12,503,916	T413I	probably benign	Het
Tm9sf1	C	T	14: 55,637,935	A451T	possibly damaging	Het
Ttn	A	T	2: 76,826,152		probably benign	Het
Uba2	T	C	7: 34,154,629	I140V	possibly damaging	Het
Ushbp1	C	A	8: 71,390,118	G361*	probably null	Het
Wbp2nl	C	T	15: 82,313,787	A175V	probably benign	Het
Zc3h12d	A	G	10: 7,862,566	E212G	probably damaging	Het

Other mutations in Zc3h7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01726:Zc3h7b	APN	15	81771799	missense	possibly damaging	0.95
IGL01955:Zc3h7b	APN	15	81792004	missense	probably benign	0.10
IGL02526:Zc3h7b	APN	15	81793137	missense	probably benign	0.10
IGL02582:Zc3h7b	APN	15	81769140	missense	probably benign	0.05
IGL02736:Zc3h7b	APN	15	81791974	missense	probably benign	0.02
F6893:Zc3h7b	UTSW	15	81778671	missense	possibly damaging	0.94
R0212:Zc3h7b	UTSW	15	81776328	missense	probably benign	0.00
R0471:Zc3h7b	UTSW	15	81781968	missense	probably damaging	1.00
R0590:Zc3h7b	UTSW	15	81776998	missense	possibly damaging	0.74
R1530:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1563:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1565:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1566:Zc3h7b	UTSW	15	81768834	missense	possibly damaging	0.91
R1670:Zc3h7b	UTSW	15	81777067	missense	probably benign
R1712:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1727:Zc3h7b	UTSW	15	81768029	missense	probably damaging	1.00
R2069:Zc3h7b	UTSW	15	81792328	missense	probably damaging	0.98
R2375:Zc3h7b	UTSW	15	81792502	missense	probably benign	0.17
R2656:Zc3h7b	UTSW	15	81780430	missense	probably damaging	1.00
R4660:Zc3h7b	UTSW	15	81792250	missense	probably benign	0.07
R4764:Zc3h7b	UTSW	15	81769183	critical splice donor site	probably null
R4815:Zc3h7b	UTSW	15	81793663	missense	probably damaging	1.00
R4999:Zc3h7b	UTSW	15	81779133	missense	probably damaging	1.00
R5086:Zc3h7b	UTSW	15	81793174	missense	probably damaging	0.96
R5169:Zc3h7b	UTSW	15	81773314	missense	probably benign	0.01
R5395:Zc3h7b	UTSW	15	81772501	missense	possibly damaging	0.50
R5407:Zc3h7b	UTSW	15	81785891	missense	probably damaging	0.99
R5587:Zc3h7b	UTSW	15	81771858	missense	possibly damaging	0.80
R5721:Zc3h7b	UTSW	15	81773298	missense	probably benign	0.02
R6001:Zc3h7b	UTSW	15	81792035	missense	possibly damaging	0.89
R6151:Zc3h7b	UTSW	15	81778710	critical splice donor site	probably null
R6248:Zc3h7b	UTSW	15	81783185	missense	probably damaging	1.00
R6397:Zc3h7b	UTSW	15	81792854	missense	probably benign	0.03
R6502:Zc3h7b	UTSW	15	81769051	missense	probably benign	0.01
R7248:Zc3h7b	UTSW	15	81771787	missense	possibly damaging	0.46
R7397:Zc3h7b	UTSW	15	81769153	missense	possibly damaging	0.50
R7450:Zc3h7b	UTSW	15	81783080	missense	probably benign
R7471:Zc3h7b	UTSW	15	81780481	missense	probably damaging	1.00
R7575:Zc3h7b	UTSW	15	81777885	nonsense	probably null
R7645:Zc3h7b	UTSW	15	81780602	missense	probably damaging	1.00
R7650:Zc3h7b	UTSW	15	81793650	missense	possibly damaging	0.81
R7881:Zc3h7b	UTSW	15	81780478	missense	probably damaging	1.00
R7918:Zc3h7b	UTSW	15	81768988	missense	probably damaging	0.98
R8001:Zc3h7b	UTSW	15	81779260	nonsense	probably null
R8504:Zc3h7b	UTSW	15	81780518	missense	probably damaging	1.00
R8855:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R8856:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R8857:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R8865:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R8866:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R8867:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R8868:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R9071:Zc3h7b	UTSW	15	81793763	makesense	probably null
R9136:Zc3h7b	UTSW	15	81769111	missense	probably damaging	1.00
R9169:Zc3h7b	UTSW	15	81776983	missense	probably benign	0.19
R9701:Zc3h7b	UTSW	15	81792304	missense	probably damaging	1.00
R9802:Zc3h7b	UTSW	15	81792304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTGCATCAGAACTGAGTGACTCC -3'
(R):5'- ACCAGAGCCTGCTTGTAGTCCTTC -3'

Sequencing Primer
(F):5'- AACTGAGTGACTCCATGCTG -3'
(R):5'- GGCAAACAGGTTCTGCAC -3'

Posted On

2013-07-11