Incidental Mutation 'R7733:Clec4a1'
ID595982
Institutional Source Beutler Lab
Gene Symbol Clec4a1
Ensembl Gene ENSMUSG00000049037
Gene NameC-type lectin domain family 4, member a1
SynonymsmDcir4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7733 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location122921848-122934619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122932150 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 159 (D159G)
Ref Sequence ENSEMBL: ENSMUSP00000062441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060484]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060484
AA Change: D159G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062441
Gene: ENSMUSG00000049037
AA Change: D159G

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
CLECT 114 239 8.08e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (83/83)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik T A 6: 133,294,277 S95T probably benign Het
9530053A07Rik A T 7: 28,139,965 D401V probably damaging Het
Abca8a A G 11: 110,054,587 F1070L probably benign Het
Acsl3 G C 1: 78,688,236 probably null Het
Adarb2 T A 13: 8,752,608 S640T possibly damaging Het
Adgre5 T C 8: 83,729,396 D257G probably benign Het
Adora2b A T 11: 62,265,339 I205F possibly damaging Het
Asb14 A G 14: 26,912,352 M505V probably benign Het
Atrnl1 T C 19: 57,701,988 V876A probably benign Het
AU040320 A G 4: 126,835,529 N495D possibly damaging Het
BC005561 T C 5: 104,519,960 F783L possibly damaging Het
Bcam A T 7: 19,760,388 V361E probably benign Het
Cbwd1 T C 19: 24,940,794 D204G probably damaging Het
Ccdc7a T A 8: 128,993,052 E247V probably damaging Het
Cd84 T A 1: 171,840,659 M1K probably null Het
Cfap43 C T 19: 47,897,993 R61H possibly damaging Het
Ctcfl C T 2: 173,117,192 R247Q probably benign Het
Ctdnep1 G A 11: 69,990,009 R236Q probably damaging Het
Cwf19l2 A T 9: 3,450,066 H589L probably benign Het
Cyp2u1 G T 3: 131,303,027 A34E probably benign Het
Cyp4x1 A G 4: 115,120,194 S281P possibly damaging Het
Dag1 T C 9: 108,208,848 T365A probably benign Het
Dhx57 A T 17: 80,265,074 probably null Het
Dnajb1 T G 8: 83,608,377 S16A probably benign Het
Dsc2 A T 18: 20,048,315 L145Q probably benign Het
Dsc2 G C 18: 20,048,316 L145V probably benign Het
Eefsec T C 6: 88,376,220 T156A possibly damaging Het
Eif6 T A 2: 155,823,232 D169V probably benign Het
Ell3 C A 2: 121,442,520 G3V possibly damaging Het
Eprs A T 1: 185,397,161 H615L probably benign Het
Fbxw10 A G 11: 62,873,397 Y630C unknown Het
G6pc2 C T 2: 69,220,183 Q51* probably null Het
Glt8d1 C T 14: 31,001,978 probably benign Het
Gm16486 A G 8: 70,717,451 T1397A possibly damaging Het
Gpr4 T C 7: 19,222,710 Y186H probably damaging Het
Grhpr T C 4: 44,981,494 probably benign Het
Gsdma3 A G 11: 98,635,215 H264R probably damaging Het
Hcfc2 A G 10: 82,739,179 Y224C probably benign Het
Helz2 A G 2: 181,230,355 F2608S possibly damaging Het
Herc2 C T 7: 56,188,664 T3313M probably damaging Het
Hmgcl A T 4: 135,960,083 H223L probably benign Het
Igf2r A G 17: 12,739,369 V139A possibly damaging Het
Kif5a T A 10: 127,236,740 T727S probably benign Het
Kifc1 G A 17: 33,883,569 R357W probably damaging Het
Krt81 T A 15: 101,463,514 S62C probably damaging Het
Lgi2 T C 5: 52,538,531 N362S probably benign Het
Lig1 G T 7: 13,296,231 R378L possibly damaging Het
Map3k13 C T 16: 21,921,686 R588C probably damaging Het
Mov10l1 T A 15: 89,024,801 F1008L probably damaging Het
Nr4a2 A G 2: 57,112,321 V40A probably benign Het
Nrde2 A T 12: 100,144,140 C206S possibly damaging Het
Olfr1316 C T 2: 112,130,041 V257I probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Pcdhb12 A G 18: 37,437,036 T412A probably damaging Het
Plekhh2 T A 17: 84,583,524 Y839* probably null Het
Pnpla6 T A 8: 3,522,660 F316I probably benign Het
Prcp C T 7: 92,901,298 T101M probably damaging Het
Prex2 G T 1: 11,181,959 R1076L probably benign Het
Prpf40b T C 15: 99,308,343 probably null Het
Psd3 T G 8: 68,120,916 K204N possibly damaging Het
Ptpro C A 6: 137,414,286 C801* probably null Het
Ptprt A G 2: 161,575,787 V923A probably damaging Het
Ptprz1 T A 6: 23,000,384 D824E probably benign Het
Rasgrf1 A G 9: 89,981,727 D582G probably benign Het
Rfc2 T C 5: 134,593,216 L183P probably damaging Het
Rnf114 T C 2: 167,512,518 V173A probably damaging Het
Scn3a T A 2: 65,508,650 I562F probably benign Het
Setmar T C 6: 108,076,127 I194T probably damaging Het
Sptb A T 12: 76,597,921 probably null Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sptlc3 G T 2: 139,631,368 M512I possibly damaging Het
Svep1 C A 4: 58,049,239 A3423S probably benign Het
Sycp1 T C 3: 102,895,962 T511A probably benign Het
Synm T A 7: 67,735,945 probably null Het
Tada1 C T 1: 166,389,942 P216L probably damaging Het
Tas2r117 T A 6: 132,803,175 M92K probably benign Het
Thsd1 T C 8: 22,258,721 L536P probably damaging Het
Timp2 T G 11: 118,317,529 probably null Het
Trak1 T A 9: 121,367,225 V41D possibly damaging Het
Ubqln3 T A 7: 104,141,076 L602F probably damaging Het
Vmn2r59 A G 7: 42,012,019 F791L probably benign Het
Wbp4 A G 14: 79,477,040 probably null Het
Other mutations in Clec4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Clec4a1 APN 6 122922055 missense possibly damaging 0.53
IGL00932:Clec4a1 APN 6 122930695 missense probably damaging 1.00
IGL01973:Clec4a1 APN 6 122930721 missense probably damaging 1.00
IGL01976:Clec4a1 APN 6 122928074 splice site probably benign
IGL02009:Clec4a1 APN 6 122932216 missense probably benign 0.09
IGL02629:Clec4a1 APN 6 122932147 critical splice acceptor site probably null
IGL03180:Clec4a1 APN 6 122924818 missense probably benign 0.08
R1973:Clec4a1 UTSW 6 122924834 splice site probably null
R4582:Clec4a1 UTSW 6 122932191 missense possibly damaging 0.58
R4758:Clec4a1 UTSW 6 122933866 missense probably damaging 0.97
R4937:Clec4a1 UTSW 6 122930695 missense probably damaging 1.00
R5362:Clec4a1 UTSW 6 122932237 missense probably damaging 1.00
R6247:Clec4a1 UTSW 6 122928042 missense probably benign 0.10
R6748:Clec4a1 UTSW 6 122933897 missense possibly damaging 0.72
R7387:Clec4a1 UTSW 6 122922057 missense possibly damaging 0.91
R7481:Clec4a1 UTSW 6 122928039 missense probably damaging 1.00
Z1177:Clec4a1 UTSW 6 122933892 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GTCAATGACCATGCTATCCTCAC -3'
(R):5'- AGCTAGTTCAGTCCTATAATCCAAC -3'

Sequencing Primer
(F):5'- TTGTAAGTCCATCTTTGGGAACATG -3'
(R):5'- TCCAACACATTAAACTCCCTGCATG -3'
Posted On2019-11-12