Incidental Mutation 'R7733:Dhx57'
ID 596023
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DExH-box helicase 57
Synonyms
MMRRC Submission 045789-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R7733 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 80545733-80597620 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 80572503 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably null
Transcript: ENSMUST00000038166
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086555
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086555
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (83/83)
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik T A 6: 133,271,240 (GRCm39) S95T probably benign Het
Abca8a A G 11: 109,945,413 (GRCm39) F1070L probably benign Het
Acsl3 G C 1: 78,665,953 (GRCm39) probably null Het
Adarb2 T A 13: 8,802,644 (GRCm39) S640T possibly damaging Het
Adgre5 T C 8: 84,456,025 (GRCm39) D257G probably benign Het
Adora2b A T 11: 62,156,165 (GRCm39) I205F possibly damaging Het
Asb14 A G 14: 26,634,309 (GRCm39) M505V probably benign Het
Atrnl1 T C 19: 57,690,420 (GRCm39) V876A probably benign Het
AU040320 A G 4: 126,729,322 (GRCm39) N495D possibly damaging Het
Bcam A T 7: 19,494,313 (GRCm39) V361E probably benign Het
Ccdc7a T A 8: 129,719,533 (GRCm39) E247V probably damaging Het
Cd84 T A 1: 171,668,226 (GRCm39) M1K probably null Het
Cfap43 C T 19: 47,886,432 (GRCm39) R61H possibly damaging Het
Clec4a1 A G 6: 122,909,109 (GRCm39) D159G possibly damaging Het
Ctcfl C T 2: 172,958,985 (GRCm39) R247Q probably benign Het
Ctdnep1 G A 11: 69,880,835 (GRCm39) R236Q probably damaging Het
Cwf19l2 A T 9: 3,450,066 (GRCm39) H589L probably benign Het
Cyp2u1 G T 3: 131,096,676 (GRCm39) A34E probably benign Het
Cyp4x1 A G 4: 114,977,391 (GRCm39) S281P possibly damaging Het
Dag1 T C 9: 108,086,047 (GRCm39) T365A probably benign Het
Dnajb1 T G 8: 84,335,006 (GRCm39) S16A probably benign Het
Dsc2 A T 18: 20,181,372 (GRCm39) L145Q probably benign Het
Dsc2 G C 18: 20,181,373 (GRCm39) L145V probably benign Het
Eefsec T C 6: 88,353,202 (GRCm39) T156A possibly damaging Het
Eif6 T A 2: 155,665,152 (GRCm39) D169V probably benign Het
Ell3 C A 2: 121,273,001 (GRCm39) G3V possibly damaging Het
Eprs1 A T 1: 185,129,358 (GRCm39) H615L probably benign Het
Fbxw10 A G 11: 62,764,223 (GRCm39) Y630C unknown Het
Fcgbpl1 A T 7: 27,839,390 (GRCm39) D401V probably damaging Het
G6pc2 C T 2: 69,050,527 (GRCm39) Q51* probably null Het
Glt8d1 C T 14: 30,723,935 (GRCm39) probably benign Het
Gpr4 T C 7: 18,956,635 (GRCm39) Y186H probably damaging Het
Grhpr T C 4: 44,981,494 (GRCm39) probably benign Het
Gsdma3 A G 11: 98,526,041 (GRCm39) H264R probably damaging Het
Hcfc2 A G 10: 82,575,013 (GRCm39) Y224C probably benign Het
Helz2 A G 2: 180,872,148 (GRCm39) F2608S possibly damaging Het
Herc2 C T 7: 55,838,412 (GRCm39) T3313M probably damaging Het
Hmgcl A T 4: 135,687,394 (GRCm39) H223L probably benign Het
Igf2r A G 17: 12,958,256 (GRCm39) V139A possibly damaging Het
Iqcn A G 8: 71,170,100 (GRCm39) T1397A possibly damaging Het
Kif5a T A 10: 127,072,609 (GRCm39) T727S probably benign Het
Kifc1 G A 17: 34,102,543 (GRCm39) R357W probably damaging Het
Krt81 T A 15: 101,361,395 (GRCm39) S62C probably damaging Het
Lgi2 T C 5: 52,695,873 (GRCm39) N362S probably benign Het
Lig1 G T 7: 13,030,157 (GRCm39) R378L possibly damaging Het
Map3k13 C T 16: 21,740,436 (GRCm39) R588C probably damaging Het
Mov10l1 T A 15: 88,909,004 (GRCm39) F1008L probably damaging Het
Nr4a2 A G 2: 57,002,333 (GRCm39) V40A probably benign Het
Nrde2 A T 12: 100,110,399 (GRCm39) C206S possibly damaging Het
Or4f14d C T 2: 111,960,386 (GRCm39) V257I probably benign Het
Parp1 T C 1: 180,427,777 (GRCm39) probably null Het
Pcdhb12 A G 18: 37,570,089 (GRCm39) T412A probably damaging Het
Plekhh2 T A 17: 84,890,952 (GRCm39) Y839* probably null Het
Pnpla6 T A 8: 3,572,660 (GRCm39) F316I probably benign Het
Prcp C T 7: 92,550,506 (GRCm39) T101M probably damaging Het
Prex2 G T 1: 11,252,183 (GRCm39) R1076L probably benign Het
Prpf40b T C 15: 99,206,224 (GRCm39) probably null Het
Psd3 T G 8: 68,573,568 (GRCm39) K204N possibly damaging Het
Ptpro C A 6: 137,391,284 (GRCm39) C801* probably null Het
Ptprt A G 2: 161,417,707 (GRCm39) V923A probably damaging Het
Ptprz1 T A 6: 23,000,383 (GRCm39) D824E probably benign Het
Rasgrf1 A G 9: 89,863,780 (GRCm39) D582G probably benign Het
Rfc2 T C 5: 134,622,070 (GRCm39) L183P probably damaging Het
Rnf114 T C 2: 167,354,438 (GRCm39) V173A probably damaging Het
Scn3a T A 2: 65,338,994 (GRCm39) I562F probably benign Het
Setmar T C 6: 108,053,088 (GRCm39) I194T probably damaging Het
Sptb A T 12: 76,644,695 (GRCm39) probably null Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Sptlc3 G T 2: 139,473,288 (GRCm39) M512I possibly damaging Het
Svep1 C A 4: 58,049,239 (GRCm39) A3423S probably benign Het
Sycp1 T C 3: 102,803,278 (GRCm39) T511A probably benign Het
Synm T A 7: 67,385,693 (GRCm39) probably null Het
Tada1 C T 1: 166,217,511 (GRCm39) P216L probably damaging Het
Tas2r117 T A 6: 132,780,138 (GRCm39) M92K probably benign Het
Thoc2l T C 5: 104,667,826 (GRCm39) F783L possibly damaging Het
Thsd1 T C 8: 22,748,737 (GRCm39) L536P probably damaging Het
Timp2 T G 11: 118,208,355 (GRCm39) probably null Het
Trak1 T A 9: 121,196,291 (GRCm39) V41D possibly damaging Het
Ubqln3 T A 7: 103,790,283 (GRCm39) L602F probably damaging Het
Vmn2r59 A G 7: 41,661,443 (GRCm39) F791L probably benign Het
Wbp4 A G 14: 79,714,480 (GRCm39) probably null Het
Zng1 T C 19: 24,918,158 (GRCm39) D204G probably damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80,582,405 (GRCm39) missense probably benign 0.00
IGL00811:Dhx57 APN 17 80,560,672 (GRCm39) missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80,588,652 (GRCm39) missense probably benign 0.28
IGL01468:Dhx57 APN 17 80,563,039 (GRCm39) nonsense probably null
IGL01908:Dhx57 APN 17 80,558,872 (GRCm39) missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80,576,279 (GRCm39) missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80,567,752 (GRCm39) missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80,582,268 (GRCm39) missense probably benign 0.13
IGL02349:Dhx57 APN 17 80,563,000 (GRCm39) missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80,562,979 (GRCm39) critical splice donor site probably null
IGL02588:Dhx57 APN 17 80,576,300 (GRCm39) missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80,574,974 (GRCm39) missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80,574,978 (GRCm39) missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80,554,581 (GRCm39) missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80,565,526 (GRCm39) missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80,582,620 (GRCm39) missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80,571,404 (GRCm39) missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80,546,343 (GRCm39) missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80,558,902 (GRCm39) missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80,582,310 (GRCm39) missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80,565,550 (GRCm39) missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80,582,226 (GRCm39) missense probably benign 0.34
R0520:Dhx57 UTSW 17 80,565,604 (GRCm39) missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80,567,665 (GRCm39) nonsense probably null
R0661:Dhx57 UTSW 17 80,576,293 (GRCm39) missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80,577,800 (GRCm39) missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80,583,011 (GRCm39) missense probably benign
R0963:Dhx57 UTSW 17 80,582,956 (GRCm39) missense probably benign 0.01
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80,553,157 (GRCm39) missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80,582,655 (GRCm39) missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80,560,514 (GRCm39) critical splice donor site probably null
R1853:Dhx57 UTSW 17 80,582,308 (GRCm39) nonsense probably null
R1942:Dhx57 UTSW 17 80,572,573 (GRCm39) missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80,560,509 (GRCm39) splice site probably benign
R2106:Dhx57 UTSW 17 80,582,792 (GRCm39) missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80,580,477 (GRCm39) missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.07
R2249:Dhx57 UTSW 17 80,588,663 (GRCm39) missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80,567,845 (GRCm39) missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80,561,733 (GRCm39) missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80,549,378 (GRCm39) splice site probably null
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2874:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R3819:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R3964:Dhx57 UTSW 17 80,572,541 (GRCm39) nonsense probably null
R4535:Dhx57 UTSW 17 80,582,511 (GRCm39) missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80,582,390 (GRCm39) missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.01
R4822:Dhx57 UTSW 17 80,549,596 (GRCm39) splice site probably null
R4863:Dhx57 UTSW 17 80,560,540 (GRCm39) missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80,558,827 (GRCm39) missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80,582,510 (GRCm39) missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80,561,808 (GRCm39) missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80,546,302 (GRCm39) missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80,553,235 (GRCm39) missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80,571,375 (GRCm39) critical splice donor site probably null
R6177:Dhx57 UTSW 17 80,580,395 (GRCm39) missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80,582,234 (GRCm39) missense probably benign 0.00
R6802:Dhx57 UTSW 17 80,582,750 (GRCm39) missense probably benign 0.43
R6924:Dhx57 UTSW 17 80,546,244 (GRCm39) missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80,580,476 (GRCm39) missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80,575,006 (GRCm39) missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80,563,000 (GRCm39) missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80,554,542 (GRCm39) missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80,582,290 (GRCm39) missense probably benign 0.06
R7748:Dhx57 UTSW 17 80,572,546 (GRCm39) missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80,546,287 (GRCm39) missense probably benign 0.04
R7772:Dhx57 UTSW 17 80,580,507 (GRCm39) missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80,553,192 (GRCm39) missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80,582,919 (GRCm39) missense probably benign 0.18
R8403:Dhx57 UTSW 17 80,585,718 (GRCm39) missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80,561,853 (GRCm39) missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80,577,794 (GRCm39) critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80,549,523 (GRCm39) missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80,561,817 (GRCm39) missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80,553,130 (GRCm39) missense probably benign 0.09
R9717:Dhx57 UTSW 17 80,582,447 (GRCm39) missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80,558,777 (GRCm39) missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80,553,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGACGTTAAGGTCACACAC -3'
(R):5'- AAGTCACTAGTTTTCCTATGTGGC -3'

Sequencing Primer
(F):5'- CTTAACATCTGGCAAGGGGATAC -3'
(R):5'- ATGTGGCACATGTCTGACC -3'
Posted On 2019-11-12