Mutagenetix > Incidental Mutation

Incidental Mutation 'R7733:Dsc2'

596025

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7733 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20048315 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 145 (L145Q)

Ref Sequence

ENSEMBL: ENSMUSP00000042905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably benign
Transcript: ENSMUST00000039247
AA Change: L145Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: L145Q

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075214
AA Change: L145Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: L145Q

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.3%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5530400C23Rik	T	A	6: 133,294,277	S95T	probably benign	Het
9530053A07Rik	A	T	7: 28,139,965	D401V	probably damaging	Het
Abca8a	A	G	11: 110,054,587	F1070L	probably benign	Het
Acsl3	G	C	1: 78,688,236		probably null	Het
Adarb2	T	A	13: 8,752,608	S640T	possibly damaging	Het
Adgre5	T	C	8: 83,729,396	D257G	probably benign	Het
Adora2b	A	T	11: 62,265,339	I205F	possibly damaging	Het
Asb14	A	G	14: 26,912,352	M505V	probably benign	Het
Atrnl1	T	C	19: 57,701,988	V876A	probably benign	Het
AU040320	A	G	4: 126,835,529	N495D	possibly damaging	Het
BC005561	T	C	5: 104,519,960	F783L	possibly damaging	Het
Bcam	A	T	7: 19,760,388	V361E	probably benign	Het
Cbwd1	T	C	19: 24,940,794	D204G	probably damaging	Het
Ccdc7a	T	A	8: 128,993,052	E247V	probably damaging	Het
Cd84	T	A	1: 171,840,659	M1K	probably null	Het
Cfap43	C	T	19: 47,897,993	R61H	possibly damaging	Het
Clec4a1	A	G	6: 122,932,150	D159G	possibly damaging	Het
Ctcfl	C	T	2: 173,117,192	R247Q	probably benign	Het
Ctdnep1	G	A	11: 69,990,009	R236Q	probably damaging	Het
Cwf19l2	A	T	9: 3,450,066	H589L	probably benign	Het
Cyp2u1	G	T	3: 131,303,027	A34E	probably benign	Het
Cyp4x1	A	G	4: 115,120,194	S281P	possibly damaging	Het
Dag1	T	C	9: 108,208,848	T365A	probably benign	Het
Dhx57	A	T	17: 80,265,074		probably null	Het
Dnajb1	T	G	8: 83,608,377	S16A	probably benign	Het
Eefsec	T	C	6: 88,376,220	T156A	possibly damaging	Het
Eif6	T	A	2: 155,823,232	D169V	probably benign	Het
Ell3	C	A	2: 121,442,520	G3V	possibly damaging	Het
Eprs	A	T	1: 185,397,161	H615L	probably benign	Het
Fbxw10	A	G	11: 62,873,397	Y630C	unknown	Het
G6pc2	C	T	2: 69,220,183	Q51*	probably null	Het
Glt8d1	C	T	14: 31,001,978		probably benign	Het
Gm16486	A	G	8: 70,717,451	T1397A	possibly damaging	Het
Gpr4	T	C	7: 19,222,710	Y186H	probably damaging	Het
Grhpr	T	C	4: 44,981,494		probably benign	Het
Gsdma3	A	G	11: 98,635,215	H264R	probably damaging	Het
Hcfc2	A	G	10: 82,739,179	Y224C	probably benign	Het
Helz2	A	G	2: 181,230,355	F2608S	possibly damaging	Het
Herc2	C	T	7: 56,188,664	T3313M	probably damaging	Het
Hmgcl	A	T	4: 135,960,083	H223L	probably benign	Het
Igf2r	A	G	17: 12,739,369	V139A	possibly damaging	Het
Kif5a	T	A	10: 127,236,740	T727S	probably benign	Het
Kifc1	G	A	17: 33,883,569	R357W	probably damaging	Het
Krt81	T	A	15: 101,463,514	S62C	probably damaging	Het
Lgi2	T	C	5: 52,538,531	N362S	probably benign	Het
Lig1	G	T	7: 13,296,231	R378L	possibly damaging	Het
Map3k13	C	T	16: 21,921,686	R588C	probably damaging	Het
Mov10l1	T	A	15: 89,024,801	F1008L	probably damaging	Het
Nr4a2	A	G	2: 57,112,321	V40A	probably benign	Het
Nrde2	A	T	12: 100,144,140	C206S	possibly damaging	Het
Olfr1316	C	T	2: 112,130,041	V257I	probably benign	Het
Parp1	T	C	1: 180,600,212		probably null	Het
Pcdhb12	A	G	18: 37,437,036	T412A	probably damaging	Het
Plekhh2	T	A	17: 84,583,524	Y839*	probably null	Het
Pnpla6	T	A	8: 3,522,660	F316I	probably benign	Het
Prcp	C	T	7: 92,901,298	T101M	probably damaging	Het
Prex2	G	T	1: 11,181,959	R1076L	probably benign	Het
Prpf40b	T	C	15: 99,308,343		probably null	Het
Psd3	T	G	8: 68,120,916	K204N	possibly damaging	Het
Ptpro	C	A	6: 137,414,286	C801*	probably null	Het
Ptprt	A	G	2: 161,575,787	V923A	probably damaging	Het
Ptprz1	T	A	6: 23,000,384	D824E	probably benign	Het
Rasgrf1	A	G	9: 89,981,727	D582G	probably benign	Het
Rfc2	T	C	5: 134,593,216	L183P	probably damaging	Het
Rnf114	T	C	2: 167,512,518	V173A	probably damaging	Het
Scn3a	T	A	2: 65,508,650	I562F	probably benign	Het
Setmar	T	C	6: 108,076,127	I194T	probably damaging	Het
Sptb	A	T	12: 76,597,921		probably null	Het
Sptbn2	C	G	19: 4,749,012	R2037G	probably benign	Het
Sptlc3	G	T	2: 139,631,368	M512I	possibly damaging	Het
Svep1	C	A	4: 58,049,239	A3423S	probably benign	Het
Sycp1	T	C	3: 102,895,962	T511A	probably benign	Het
Synm	T	A	7: 67,735,945		probably null	Het
Tada1	C	T	1: 166,389,942	P216L	probably damaging	Het
Tas2r117	T	A	6: 132,803,175	M92K	probably benign	Het
Thsd1	T	C	8: 22,258,721	L536P	probably damaging	Het
Timp2	T	G	11: 118,317,529		probably null	Het
Trak1	T	A	9: 121,367,225	V41D	possibly damaging	Het
Ubqln3	T	A	7: 104,141,076	L602F	probably damaging	Het
Vmn2r59	A	G	7: 42,012,019	F791L	probably benign	Het
Wbp4	A	G	14: 79,477,040		probably null	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCATGGTACCTAAACCTTCC -3'
(R):5'- GTCCCTAGCCAATCCTTATGAGAG -3'

Sequencing Primer
(F):5'- TCACTCAAAGTCTCAAGTATAGCAGG -3'
(R):5'- TCCTTATGAGAGGAGACAAATGTATC -3'

Posted On

2019-11-12