Incidental Mutation 'R7734:Edem3'
ID596034
Institutional Source Beutler Lab
Gene Symbol Edem3
Ensembl Gene ENSMUSG00000043019
Gene NameER degradation enhancer, mannosidase alpha-like 3
Synonyms2310050N11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R7734 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location151755371-151822051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151818585 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 890 (S890P)
Ref Sequence ENSEMBL: ENSMUSP00000058941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059498] [ENSMUST00000187951] [ENSMUST00000188145] [ENSMUST00000191070]
Predicted Effect probably benign
Transcript: ENSMUST00000059498
AA Change: S890P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058941
Gene: ENSMUSG00000043019
AA Change: S890P

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3.5e-118 PFAM
low complexity region 635 648 N/A INTRINSIC
Pfam:PA 672 778 9.4e-16 PFAM
low complexity region 838 855 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187951
AA Change: S872P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140775
Gene: ENSMUSG00000043019
AA Change: S872P

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 1.8e-147 PFAM
low complexity region 617 630 N/A INTRINSIC
Pfam:PA 658 762 1.6e-17 PFAM
low complexity region 820 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188145
AA Change: S906P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140443
Gene: ENSMUSG00000043019
AA Change: S906P

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3.3e-144 PFAM
low complexity region 635 648 N/A INTRINSIC
Pfam:PA 676 780 4.3e-15 PFAM
low complexity region 854 871 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191070
AA Change: S876P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140234
Gene: ENSMUSG00000043019
AA Change: S876P

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3e-144 PFAM
low complexity region 616 629 N/A INTRINSIC
Pfam:PA 657 761 4.1e-15 PFAM
low complexity region 824 841 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Quality control in the endoplasmic reticulum (ER) ensures that only properly folded proteins are retained in the cell through recognition and degradation of misfolded or unassembled proteins. EDEM3 belongs to a group of proteins that accelerate degradation of misfolded glycoproteins in the ER (Hirao et al., 2006 [PubMed 16431915]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T A 18: 12,189,263 I591N possibly damaging Het
Anxa2 T C 9: 69,491,482 Y333H probably benign Het
Arid1a A T 4: 133,681,368 F1558I unknown Het
Aste1 A G 9: 105,397,479 D306G probably damaging Het
Atp2a2 A G 5: 122,458,527 V843A possibly damaging Het
Atrip T A 9: 109,065,506 H451L probably benign Het
Cdc42bpb T C 12: 111,329,230 D200G probably damaging Het
Ceacam19 A C 7: 19,886,595 M37R probably benign Het
Cemip G A 7: 83,957,664 R782* probably null Het
Cpe A T 8: 64,617,620 I197N probably benign Het
Csmd2 C A 4: 128,552,057 P3307T Het
Cyp4a12b C A 4: 115,411,740 Q20K possibly damaging Het
Dcaf1 T C 9: 106,838,679 Y332H probably damaging Het
Dclk3 A G 9: 111,469,095 H569R probably damaging Het
Dcp1b A G 6: 119,215,283 S387G probably benign Het
Ddx24 A G 12: 103,417,560 M590T possibly damaging Het
Dixdc1 T G 9: 50,701,968 Q229P probably damaging Het
Dnase1l3 T C 14: 7,977,144 R181G probably benign Het
Dzip1l A T 9: 99,667,682 D735V probably damaging Het
Fuom A G 7: 140,099,542 L155P unknown Het
Gm6408 C A 5: 146,484,350 S263* probably null Het
Helz C G 11: 107,685,422 S1814R unknown Het
Hrc T C 7: 45,336,676 L417P probably benign Het
Igdcc4 A C 9: 65,131,753 H894P probably damaging Het
Lgr6 C A 1: 135,003,243 V296L probably damaging Het
Map3k4 T A 17: 12,264,111 Y573F probably damaging Het
Mest T C 6: 30,746,300 Y296H unknown Het
Mettl21a C T 1: 64,608,129 V90M probably damaging Het
Mfsd4b1 A T 10: 40,007,378 N25K probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Myo15 G A 11: 60,510,282 V3028M probably benign Het
Nlrp1a T A 11: 71,108,000 N859I unknown Het
Nrcam T C 12: 44,537,251 L36P possibly damaging Het
Nup107 C A 10: 117,758,012 E759* probably null Het
Olfr305 A G 7: 86,364,268 I23T not run Het
Pcdh7 T G 5: 57,719,634 I177S probably damaging Het
Pde6a T C 18: 61,232,866 I221T probably benign Het
Ptpn13 A T 5: 103,561,962 N1497I probably damaging Het
Rpl4 T A 9: 64,177,379 H245Q probably benign Het
Rsf1 C CCACGGCGGG 7: 97,579,908 probably benign Het
Scara5 A G 14: 65,731,151 D291G possibly damaging Het
Sept14 T A 5: 129,683,519 I422L probably benign Het
Serpina1e T C 12: 103,950,892 K173E probably benign Het
Slc5a1 C T 5: 33,160,935 T644I probably benign Het
Slc6a13 A T 6: 121,337,375 T590S probably benign Het
Smarca4 C T 9: 21,667,362 T938I possibly damaging Het
Stxbp1 A T 2: 32,801,820 D453E probably benign Het
Tcf12 C A 9: 71,922,661 V173L probably benign Het
Tenm3 A G 8: 48,646,333 C146R probably damaging Het
Trim11 T C 11: 58,978,354 C39R probably damaging Het
Trim37 A G 11: 87,177,995 Y389C probably damaging Het
Ttll8 C T 15: 88,914,165 G789D probably damaging Het
Tubb2a C T 13: 34,074,793 S338N probably benign Het
Ulk2 G A 11: 61,853,301 Q50* probably null Het
Urgcp T C 11: 5,716,406 D687G probably benign Het
Usp13 C T 3: 32,837,905 H78Y probably benign Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Vwc2 G A 11: 11,115,929 A6T possibly damaging Het
Other mutations in Edem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Edem3 APN 1 151818513 missense probably benign
IGL01065:Edem3 APN 1 151777551 missense probably damaging 1.00
IGL01351:Edem3 APN 1 151792385 missense possibly damaging 0.95
IGL01451:Edem3 APN 1 151818628 missense probably benign 0.21
IGL01831:Edem3 APN 1 151796082 missense probably damaging 0.97
IGL02096:Edem3 APN 1 151804719 missense probably benign 0.00
IGL02207:Edem3 APN 1 151808360 missense possibly damaging 0.77
IGL02507:Edem3 APN 1 151811656 missense probably benign 0.20
IGL02690:Edem3 APN 1 151804799 missense probably damaging 1.00
Abel UTSW 1 151811519 missense probably damaging 1.00
adam UTSW 1 151811596 nonsense probably null
eve UTSW 1 151812614 splice site probably null
R0421:Edem3 UTSW 1 151792438 splice site probably benign
R1463:Edem3 UTSW 1 151807510 missense possibly damaging 0.81
R1934:Edem3 UTSW 1 151804283 missense probably damaging 1.00
R1958:Edem3 UTSW 1 151804325 missense probably damaging 1.00
R2090:Edem3 UTSW 1 151804826 splice site probably benign
R2126:Edem3 UTSW 1 151794731 missense possibly damaging 0.76
R2191:Edem3 UTSW 1 151796883 missense probably damaging 1.00
R2211:Edem3 UTSW 1 151804702 missense possibly damaging 0.74
R4005:Edem3 UTSW 1 151759755 missense probably damaging 1.00
R4018:Edem3 UTSW 1 151804826 splice site probably benign
R4723:Edem3 UTSW 1 151804698 missense possibly damaging 0.95
R4818:Edem3 UTSW 1 151792385 missense possibly damaging 0.95
R4871:Edem3 UTSW 1 151804231 splice site probably null
R5205:Edem3 UTSW 1 151811519 missense probably damaging 1.00
R5347:Edem3 UTSW 1 151807451 missense probably damaging 0.97
R5910:Edem3 UTSW 1 151770827 splice site probably null
R7021:Edem3 UTSW 1 151755672 missense probably benign 0.01
R7366:Edem3 UTSW 1 151812614 splice site probably null
R7481:Edem3 UTSW 1 151808222 missense probably damaging 0.98
R7481:Edem3 UTSW 1 151808223 missense possibly damaging 0.46
R7773:Edem3 UTSW 1 151811596 nonsense probably null
R7828:Edem3 UTSW 1 151811635 missense possibly damaging 0.51
R8556:Edem3 UTSW 1 151784835 missense possibly damaging 0.77
R8559:Edem3 UTSW 1 151818418 missense probably benign 0.27
R8724:Edem3 UTSW 1 151775873 missense possibly damaging 0.79
X0028:Edem3 UTSW 1 151818562 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GCTCTCGCTTTCTCAGACAG -3'
(R):5'- GTGGGTGTCACAAACCACAG -3'

Sequencing Primer
(F):5'- TCTCAGACAGTCGACTTGGCTG -3'
(R):5'- GTGGGTGTCACAAACCACAGTTTAC -3'
Posted On2019-11-12