Incidental Mutation 'R7734:Cyp4a12b'
ID596037
Institutional Source Beutler Lab
Gene Symbol Cyp4a12b
Ensembl Gene ENSMUSG00000078597
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 12B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7734 (G1)
Quality Score120.008
Status Not validated
Chromosome4
Chromosomal Location115411624-115439034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115411740 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 20 (Q20K)
Ref Sequence ENSEMBL: ENSMUSP00000092487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094887]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094887
AA Change: Q20K

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092487
Gene: ENSMUSG00000078597
AA Change: Q20K

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:p450 51 503 1.9e-132 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T A 18: 12,189,263 I591N possibly damaging Het
Anxa2 T C 9: 69,491,482 Y333H probably benign Het
Arid1a A T 4: 133,681,368 F1558I unknown Het
Aste1 A G 9: 105,397,479 D306G probably damaging Het
Atp2a2 A G 5: 122,458,527 V843A possibly damaging Het
Atrip T A 9: 109,065,506 H451L probably benign Het
Cdc42bpb T C 12: 111,329,230 D200G probably damaging Het
Ceacam19 A C 7: 19,886,595 M37R probably benign Het
Cemip G A 7: 83,957,664 R782* probably null Het
Cpe A T 8: 64,617,620 I197N probably benign Het
Csmd2 C A 4: 128,552,057 P3307T Het
Dcaf1 T C 9: 106,838,679 Y332H probably damaging Het
Dclk3 A G 9: 111,469,095 H569R probably damaging Het
Dcp1b A G 6: 119,215,283 S387G probably benign Het
Ddx24 A G 12: 103,417,560 M590T possibly damaging Het
Dixdc1 T G 9: 50,701,968 Q229P probably damaging Het
Dnase1l3 T C 14: 7,977,144 R181G probably benign Het
Dzip1l A T 9: 99,667,682 D735V probably damaging Het
Edem3 T C 1: 151,818,585 S890P probably benign Het
Fuom A G 7: 140,099,542 L155P unknown Het
Gm6408 C A 5: 146,484,350 S263* probably null Het
Helz C G 11: 107,685,422 S1814R unknown Het
Hrc T C 7: 45,336,676 L417P probably benign Het
Igdcc4 A C 9: 65,131,753 H894P probably damaging Het
Lgr6 C A 1: 135,003,243 V296L probably damaging Het
Map3k4 T A 17: 12,264,111 Y573F probably damaging Het
Mest T C 6: 30,746,300 Y296H unknown Het
Mettl21a C T 1: 64,608,129 V90M probably damaging Het
Mfsd4b1 A T 10: 40,007,378 N25K probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Myo15 G A 11: 60,510,282 V3028M probably benign Het
Nlrp1a T A 11: 71,108,000 N859I unknown Het
Nrcam T C 12: 44,537,251 L36P possibly damaging Het
Nup107 C A 10: 117,758,012 E759* probably null Het
Olfr305 A G 7: 86,364,268 I23T not run Het
Pcdh7 T G 5: 57,719,634 I177S probably damaging Het
Pde6a T C 18: 61,232,866 I221T probably benign Het
Ptpn13 A T 5: 103,561,962 N1497I probably damaging Het
Rpl4 T A 9: 64,177,379 H245Q probably benign Het
Rsf1 C CCACGGCGGG 7: 97,579,908 probably benign Het
Scara5 A G 14: 65,731,151 D291G possibly damaging Het
Sept14 T A 5: 129,683,519 I422L probably benign Het
Serpina1e T C 12: 103,950,892 K173E probably benign Het
Slc5a1 C T 5: 33,160,935 T644I probably benign Het
Slc6a13 A T 6: 121,337,375 T590S probably benign Het
Smarca4 C T 9: 21,667,362 T938I possibly damaging Het
Stxbp1 A T 2: 32,801,820 D453E probably benign Het
Tcf12 C A 9: 71,922,661 V173L probably benign Het
Tenm3 A G 8: 48,646,333 C146R probably damaging Het
Trim11 T C 11: 58,978,354 C39R probably damaging Het
Trim37 A G 11: 87,177,995 Y389C probably damaging Het
Ttll8 C T 15: 88,914,165 G789D probably damaging Het
Tubb2a C T 13: 34,074,793 S338N probably benign Het
Ulk2 G A 11: 61,853,301 Q50* probably null Het
Urgcp T C 11: 5,716,406 D687G probably benign Het
Usp13 C T 3: 32,837,905 H78Y probably benign Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Vwc2 G A 11: 11,115,929 A6T possibly damaging Het
Other mutations in Cyp4a12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cyp4a12b APN 4 115438049 splice site probably null
IGL01571:Cyp4a12b APN 4 115438157 missense probably benign 0.00
IGL02230:Cyp4a12b APN 4 115433996 missense probably damaging 1.00
IGL02720:Cyp4a12b APN 4 115435171 splice site probably benign
IGL03118:Cyp4a12b APN 4 115432976 missense possibly damaging 0.54
IGL03389:Cyp4a12b APN 4 115433808 missense possibly damaging 0.90
R0360:Cyp4a12b UTSW 4 115432920 missense probably benign 0.01
R0364:Cyp4a12b UTSW 4 115432920 missense probably benign 0.01
R0844:Cyp4a12b UTSW 4 115432524 missense possibly damaging 0.67
R1226:Cyp4a12b UTSW 4 115432967 missense possibly damaging 0.80
R1232:Cyp4a12b UTSW 4 115432563 missense possibly damaging 0.81
R1372:Cyp4a12b UTSW 4 115432949 missense probably benign 0.08
R1559:Cyp4a12b UTSW 4 115433984 missense probably damaging 0.98
R1782:Cyp4a12b UTSW 4 115433981 missense probably damaging 1.00
R1817:Cyp4a12b UTSW 4 115414062 splice site probably benign
R1941:Cyp4a12b UTSW 4 115438059 missense probably damaging 1.00
R1978:Cyp4a12b UTSW 4 115438145 missense probably benign 0.01
R2063:Cyp4a12b UTSW 4 115433503 missense possibly damaging 0.87
R2109:Cyp4a12b UTSW 4 115432913 missense probably damaging 0.97
R2911:Cyp4a12b UTSW 4 115433526 nonsense probably null
R3791:Cyp4a12b UTSW 4 115434970 missense probably benign 0.01
R3815:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3816:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3817:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3818:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R4586:Cyp4a12b UTSW 4 115432506 missense probably damaging 1.00
R5004:Cyp4a12b UTSW 4 115438113 missense probably benign 0.39
R5105:Cyp4a12b UTSW 4 115433761 missense probably damaging 1.00
R5354:Cyp4a12b UTSW 4 115433464 splice site probably null
R5655:Cyp4a12b UTSW 4 115433797 missense probably damaging 1.00
R5814:Cyp4a12b UTSW 4 115432497 missense probably damaging 0.97
R5952:Cyp4a12b UTSW 4 115414517 nonsense probably null
R6004:Cyp4a12b UTSW 4 115433467 missense probably benign 0.35
R6059:Cyp4a12b UTSW 4 115438104 missense possibly damaging 0.94
R6261:Cyp4a12b UTSW 4 115414543 nonsense probably null
R7484:Cyp4a12b UTSW 4 115432563 missense possibly damaging 0.81
RF045:Cyp4a12b UTSW 4 115432493 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CAAAGGAGGCTGTTCAGGTTCATC -3'
(R):5'- GAAAGCCTCATCTTCCCTGC -3'

Sequencing Primer
(F):5'- GGTTCATCAACCCTGGTCTTGAAATC -3'
(R):5'- GCTCTCCCACCCACCCATC -3'
Posted On2019-11-12