Incidental Mutation 'R7734:Pcdh7'
ID596041
Institutional Source Beutler Lab
Gene Symbol Pcdh7
Ensembl Gene ENSMUSG00000029108
Gene Nameprotocadherin 7
SynonymsBH-protocadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R7734 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location57717967-58133230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57719634 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 177 (I177S)
Ref Sequence ENSEMBL: ENSMUSP00000142319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068110] [ENSMUST00000094783] [ENSMUST00000191837] [ENSMUST00000199310]
Predicted Effect probably damaging
Transcript: ENSMUST00000068110
AA Change: I177S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066306
Gene: ENSMUSG00000029108
AA Change: I177S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000092376
Gene: ENSMUSG00000029108
AA Change: I177S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191837
AA Change: I177S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142319
Gene: ENSMUSG00000029108
AA Change: I177S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192048
Predicted Effect probably benign
Transcript: ENSMUST00000192287
Predicted Effect probably benign
Transcript: ENSMUST00000195156
Predicted Effect probably benign
Transcript: ENSMUST00000199310
SMART Domains Protein: ENSMUSP00000143387
Gene: ENSMUSG00000029108

DomainStartEndE-ValueType
Pfam:Protocadherin 1 79 5.1e-40 PFAM
low complexity region 112 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a protein with an extracellular domain containing 7 cadherin repeats. The gene product is an integral membrane protein that is thought to function in cell-cell recognition and adhesion. Alternative splicing yields isoforms with unique cytoplasmic tails. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T A 18: 12,189,263 I591N possibly damaging Het
Anxa2 T C 9: 69,491,482 Y333H probably benign Het
Arid1a A T 4: 133,681,368 F1558I unknown Het
Aste1 A G 9: 105,397,479 D306G probably damaging Het
Atp2a2 A G 5: 122,458,527 V843A possibly damaging Het
Atrip T A 9: 109,065,506 H451L probably benign Het
Cdc42bpb T C 12: 111,329,230 D200G probably damaging Het
Ceacam19 A C 7: 19,886,595 M37R probably benign Het
Cemip G A 7: 83,957,664 R782* probably null Het
Cpe A T 8: 64,617,620 I197N probably benign Het
Csmd2 C A 4: 128,552,057 P3307T Het
Cyp4a12b C A 4: 115,411,740 Q20K possibly damaging Het
Dcaf1 T C 9: 106,838,679 Y332H probably damaging Het
Dclk3 A G 9: 111,469,095 H569R probably damaging Het
Dcp1b A G 6: 119,215,283 S387G probably benign Het
Ddx24 A G 12: 103,417,560 M590T possibly damaging Het
Dixdc1 T G 9: 50,701,968 Q229P probably damaging Het
Dnase1l3 T C 14: 7,977,144 R181G probably benign Het
Dzip1l A T 9: 99,667,682 D735V probably damaging Het
Edem3 T C 1: 151,818,585 S890P probably benign Het
Fuom A G 7: 140,099,542 L155P unknown Het
Gm6408 C A 5: 146,484,350 S263* probably null Het
Helz C G 11: 107,685,422 S1814R unknown Het
Hrc T C 7: 45,336,676 L417P probably benign Het
Igdcc4 A C 9: 65,131,753 H894P probably damaging Het
Lgr6 C A 1: 135,003,243 V296L probably damaging Het
Map3k4 T A 17: 12,264,111 Y573F probably damaging Het
Mest T C 6: 30,746,300 Y296H unknown Het
Mettl21a C T 1: 64,608,129 V90M probably damaging Het
Mfsd4b1 A T 10: 40,007,378 N25K probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Myo15 G A 11: 60,510,282 V3028M probably benign Het
Nlrp1a T A 11: 71,108,000 N859I unknown Het
Nrcam T C 12: 44,537,251 L36P possibly damaging Het
Nup107 C A 10: 117,758,012 E759* probably null Het
Olfr305 A G 7: 86,364,268 I23T not run Het
Pde6a T C 18: 61,232,866 I221T probably benign Het
Ptpn13 A T 5: 103,561,962 N1497I probably damaging Het
Rpl4 T A 9: 64,177,379 H245Q probably benign Het
Rsf1 C CCACGGCGGG 7: 97,579,908 probably benign Het
Scara5 A G 14: 65,731,151 D291G possibly damaging Het
Sept14 T A 5: 129,683,519 I422L probably benign Het
Serpina1e T C 12: 103,950,892 K173E probably benign Het
Slc5a1 C T 5: 33,160,935 T644I probably benign Het
Slc6a13 A T 6: 121,337,375 T590S probably benign Het
Smarca4 C T 9: 21,667,362 T938I possibly damaging Het
Stxbp1 A T 2: 32,801,820 D453E probably benign Het
Tcf12 C A 9: 71,922,661 V173L probably benign Het
Tenm3 A G 8: 48,646,333 C146R probably damaging Het
Trim11 T C 11: 58,978,354 C39R probably damaging Het
Trim37 A G 11: 87,177,995 Y389C probably damaging Het
Ttll8 C T 15: 88,914,165 G789D probably damaging Het
Tubb2a C T 13: 34,074,793 S338N probably benign Het
Ulk2 G A 11: 61,853,301 Q50* probably null Het
Urgcp T C 11: 5,716,406 D687G probably benign Het
Usp13 C T 3: 32,837,905 H78Y probably benign Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Vwc2 G A 11: 11,115,929 A6T possibly damaging Het
Other mutations in Pcdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Pcdh7 APN 5 57721464 missense probably damaging 1.00
IGL00920:Pcdh7 APN 5 57720131 missense probably damaging 0.96
IGL00990:Pcdh7 APN 5 57720464 missense possibly damaging 0.94
IGL01367:Pcdh7 APN 5 58129224 missense possibly damaging 0.67
IGL01388:Pcdh7 APN 5 57720204 missense probably damaging 1.00
IGL01543:Pcdh7 APN 5 57720765 missense probably damaging 1.00
IGL01750:Pcdh7 APN 5 57720422 missense probably damaging 1.00
IGL02010:Pcdh7 APN 5 58129255 missense probably benign
IGL02014:Pcdh7 APN 5 57719703 missense probably benign 0.03
IGL02269:Pcdh7 APN 5 57913322 missense probably damaging 1.00
IGL03051:Pcdh7 APN 5 58129073 missense probably damaging 0.99
floated UTSW 5 57721362 missense probably damaging 1.00
proposed UTSW 5 57722240 missense probably damaging 0.99
P0037:Pcdh7 UTSW 5 57913248 missense probably benign 0.17
R0003:Pcdh7 UTSW 5 57913248 missense probably benign 0.17
R0421:Pcdh7 UTSW 5 57720060 missense probably damaging 1.00
R0551:Pcdh7 UTSW 5 57721994 missense probably damaging 0.99
R0562:Pcdh7 UTSW 5 57720063 missense probably damaging 0.99
R0732:Pcdh7 UTSW 5 57721315 missense probably damaging 1.00
R0755:Pcdh7 UTSW 5 57720322 missense possibly damaging 0.86
R1080:Pcdh7 UTSW 5 57719426 missense probably damaging 1.00
R1381:Pcdh7 UTSW 5 57721540 nonsense probably null
R1591:Pcdh7 UTSW 5 57720422 missense probably damaging 1.00
R1891:Pcdh7 UTSW 5 57720875 missense probably damaging 0.98
R2011:Pcdh7 UTSW 5 57719629 missense probably damaging 1.00
R2140:Pcdh7 UTSW 5 58128996 missense probably damaging 1.00
R2147:Pcdh7 UTSW 5 58129116 missense possibly damaging 0.51
R2848:Pcdh7 UTSW 5 57720276 missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57721894 missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57721894 missense probably damaging 1.00
R3719:Pcdh7 UTSW 5 58129032 missense probably damaging 1.00
R4075:Pcdh7 UTSW 5 57721808 missense probably damaging 1.00
R4231:Pcdh7 UTSW 5 57719289 missense possibly damaging 0.94
R4236:Pcdh7 UTSW 5 57719289 missense possibly damaging 0.94
R4352:Pcdh7 UTSW 5 57722019 missense possibly damaging 0.88
R4420:Pcdh7 UTSW 5 58129170 missense probably benign 0.03
R4449:Pcdh7 UTSW 5 57720485 missense probably damaging 1.00
R4584:Pcdh7 UTSW 5 57721283 missense probably damaging 1.00
R4686:Pcdh7 UTSW 5 58129169 missense probably benign
R4837:Pcdh7 UTSW 5 57720411 missense possibly damaging 0.89
R4838:Pcdh7 UTSW 5 57720804 missense probably damaging 1.00
R4947:Pcdh7 UTSW 5 57721916 missense probably damaging 0.98
R5053:Pcdh7 UTSW 5 57721601 missense probably damaging 0.99
R5068:Pcdh7 UTSW 5 57722166 missense probably damaging 1.00
R5117:Pcdh7 UTSW 5 57721748 missense probably benign 0.09
R5132:Pcdh7 UTSW 5 57728121 missense probably benign
R5248:Pcdh7 UTSW 5 58129173 missense probably damaging 0.97
R5294:Pcdh7 UTSW 5 57728111 splice site probably null
R5420:Pcdh7 UTSW 5 57720187 missense probably damaging 1.00
R5777:Pcdh7 UTSW 5 57719514 missense probably damaging 1.00
R5800:Pcdh7 UTSW 5 57722225 missense probably damaging 1.00
R5834:Pcdh7 UTSW 5 57721628 missense possibly damaging 0.90
R5870:Pcdh7 UTSW 5 57720411 missense possibly damaging 0.89
R5917:Pcdh7 UTSW 5 57721755 missense probably damaging 0.96
R6014:Pcdh7 UTSW 5 57721155 missense probably damaging 0.99
R6193:Pcdh7 UTSW 5 57720324 missense probably damaging 1.00
R6240:Pcdh7 UTSW 5 57721362 missense probably damaging 1.00
R6335:Pcdh7 UTSW 5 57942265 splice site probably null
R6418:Pcdh7 UTSW 5 57721704 missense probably damaging 1.00
R6907:Pcdh7 UTSW 5 57719129 missense possibly damaging 0.53
R7058:Pcdh7 UTSW 5 57722240 missense probably damaging 0.99
R7069:Pcdh7 UTSW 5 57719784 missense probably benign 0.00
R7073:Pcdh7 UTSW 5 57720957 missense probably benign 0.19
R7463:Pcdh7 UTSW 5 57720998 missense probably benign 0.06
R7509:Pcdh7 UTSW 5 57720187 missense probably damaging 1.00
R7588:Pcdh7 UTSW 5 57719904 missense probably damaging 1.00
R7707:Pcdh7 UTSW 5 57720330 missense probably damaging 0.99
R7899:Pcdh7 UTSW 5 57719810 missense probably benign
R8194:Pcdh7 UTSW 5 57720336 missense probably damaging 1.00
X0021:Pcdh7 UTSW 5 57721484 missense possibly damaging 0.95
X0026:Pcdh7 UTSW 5 57719379 missense probably damaging 1.00
Z1177:Pcdh7 UTSW 5 57719664 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTCCTGGACTTCGAGGTGTC -3'
(R):5'- GCTCAAACACACTGCTTCGG -3'

Sequencing Primer
(F):5'- TGATAGGGCCCTCACAGAG -3'
(R):5'- ACACTGCTTCGGCCACTAG -3'
Posted On2019-11-12