Incidental Mutation 'R7734:Mest'
ID596046
Institutional Source Beutler Lab
Gene Symbol Mest
Ensembl Gene ENSMUSG00000051855
Gene Namemesoderm specific transcript
SynonymsPeg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R7734 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location30723547-30748465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30746300 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 296 (Y296H)
Ref Sequence ENSEMBL: ENSMUSP00000117713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048774] [ENSMUST00000115127] [ENSMUST00000124665] [ENSMUST00000147400] [ENSMUST00000151777] [ENSMUST00000157040] [ENSMUST00000163949] [ENSMUST00000166192]
Predicted Effect probably benign
Transcript: ENSMUST00000048774
SMART Domains Protein: ENSMUSP00000038368
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 2.6e-134 PFAM
Pfam:COP-gamma_platf 609 756 7.7e-66 PFAM
Pfam:Coatomer_g_Cpla 758 870 1.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115127
SMART Domains Protein: ENSMUSP00000110780
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
SCOP:d1qo7a_ 23 107 3e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000124665
AA Change: Y296H
SMART Domains Protein: ENSMUSP00000117713
Gene: ENSMUSG00000051855
AA Change: Y296H

DomainStartEndE-ValueType
Pfam:DUF1057 50 183 3.9e-9 PFAM
Pfam:Abhydrolase_6 79 198 7.8e-21 PFAM
Pfam:Abhydrolase_1 104 191 4.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147400
SMART Domains Protein: ENSMUSP00000120408
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
Pfam:DUF1057 35 144 3.3e-9 PFAM
Pfam:Abhydrolase_6 64 145 3.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151777
SMART Domains Protein: ENSMUSP00000115541
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
SCOP:d1qo7a_ 42 133 1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157040
AA Change: Y280H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119038
Gene: ENSMUSG00000051855
AA Change: Y280H

DomainStartEndE-ValueType
Pfam:DUF1057 34 167 3.1e-9 PFAM
Pfam:Abhydrolase_6 63 182 6.2e-21 PFAM
Pfam:Abhydrolase_1 88 176 4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163949
AA Change: Y289H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129639
Gene: ENSMUSG00000051855
AA Change: Y289H

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:DUF1057 43 176 7.1e-9 PFAM
Pfam:Abhydrolase_1 70 321 2.5e-16 PFAM
Pfam:Abhydrolase_5 71 315 5.9e-9 PFAM
Pfam:Abhydrolase_6 72 327 7.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166192
SMART Domains Protein: ENSMUSP00000126726
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 380 6.5e-92 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha/beta hydrolase superfamily. It is imprinted, exhibiting preferential expression from the paternal allele in fetal tissues, and isoform-specific imprinting in lymphocytes. The loss of imprinting of this gene has been linked to certain types of cancer and may be due to promotor switching. The encoded protein may play a role in development. Alternatively spliced transcript variants encoding multiple isoforms have been identified for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3 and 4, and the long arm of chromosomes 6 and 15. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit retardation of embryonic growth and subtle cardiac abnormalities associated with reduced postnatal survival rates. Mutant females exhibit abnormal maternal behavior and impaired placentophagia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T A 18: 12,189,263 I591N possibly damaging Het
Anxa2 T C 9: 69,491,482 Y333H probably benign Het
Arid1a A T 4: 133,681,368 F1558I unknown Het
Aste1 A G 9: 105,397,479 D306G probably damaging Het
Atp2a2 A G 5: 122,458,527 V843A possibly damaging Het
Atrip T A 9: 109,065,506 H451L probably benign Het
Cdc42bpb T C 12: 111,329,230 D200G probably damaging Het
Ceacam19 A C 7: 19,886,595 M37R probably benign Het
Cemip G A 7: 83,957,664 R782* probably null Het
Cpe A T 8: 64,617,620 I197N probably benign Het
Csmd2 C A 4: 128,552,057 P3307T Het
Cyp4a12b C A 4: 115,411,740 Q20K possibly damaging Het
Dcaf1 T C 9: 106,838,679 Y332H probably damaging Het
Dclk3 A G 9: 111,469,095 H569R probably damaging Het
Dcp1b A G 6: 119,215,283 S387G probably benign Het
Ddx24 A G 12: 103,417,560 M590T possibly damaging Het
Dixdc1 T G 9: 50,701,968 Q229P probably damaging Het
Dnase1l3 T C 14: 7,977,144 R181G probably benign Het
Dzip1l A T 9: 99,667,682 D735V probably damaging Het
Edem3 T C 1: 151,818,585 S890P probably benign Het
Fuom A G 7: 140,099,542 L155P unknown Het
Gm6408 C A 5: 146,484,350 S263* probably null Het
Helz C G 11: 107,685,422 S1814R unknown Het
Hrc T C 7: 45,336,676 L417P probably benign Het
Igdcc4 A C 9: 65,131,753 H894P probably damaging Het
Lgr6 C A 1: 135,003,243 V296L probably damaging Het
Map3k4 T A 17: 12,264,111 Y573F probably damaging Het
Mettl21a C T 1: 64,608,129 V90M probably damaging Het
Mfsd4b1 A T 10: 40,007,378 N25K probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Myo15 G A 11: 60,510,282 V3028M probably benign Het
Nlrp1a T A 11: 71,108,000 N859I unknown Het
Nrcam T C 12: 44,537,251 L36P possibly damaging Het
Nup107 C A 10: 117,758,012 E759* probably null Het
Olfr305 A G 7: 86,364,268 I23T not run Het
Pcdh7 T G 5: 57,719,634 I177S probably damaging Het
Pde6a T C 18: 61,232,866 I221T probably benign Het
Ptpn13 A T 5: 103,561,962 N1497I probably damaging Het
Rpl4 T A 9: 64,177,379 H245Q probably benign Het
Rsf1 C CCACGGCGGG 7: 97,579,908 probably benign Het
Scara5 A G 14: 65,731,151 D291G possibly damaging Het
Sept14 T A 5: 129,683,519 I422L probably benign Het
Serpina1e T C 12: 103,950,892 K173E probably benign Het
Slc5a1 C T 5: 33,160,935 T644I probably benign Het
Slc6a13 A T 6: 121,337,375 T590S probably benign Het
Smarca4 C T 9: 21,667,362 T938I possibly damaging Het
Stxbp1 A T 2: 32,801,820 D453E probably benign Het
Tcf12 C A 9: 71,922,661 V173L probably benign Het
Tenm3 A G 8: 48,646,333 C146R probably damaging Het
Trim11 T C 11: 58,978,354 C39R probably damaging Het
Trim37 A G 11: 87,177,995 Y389C probably damaging Het
Ttll8 C T 15: 88,914,165 G789D probably damaging Het
Tubb2a C T 13: 34,074,793 S338N probably benign Het
Ulk2 G A 11: 61,853,301 Q50* probably null Het
Urgcp T C 11: 5,716,406 D687G probably benign Het
Usp13 C T 3: 32,837,905 H78Y probably benign Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Vwc2 G A 11: 11,115,929 A6T possibly damaging Het
Other mutations in Mest
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Mest APN 6 30746331 unclassified probably benign
IGL02231:Mest APN 6 30740773 missense possibly damaging 0.93
IGL02386:Mest APN 6 30744914 missense possibly damaging 0.65
R0102:Mest UTSW 6 30746270 missense probably damaging 1.00
R0102:Mest UTSW 6 30746270 missense probably damaging 1.00
R0826:Mest UTSW 6 30742814 missense probably damaging 1.00
R0972:Mest UTSW 6 30740684 nonsense probably null
R1580:Mest UTSW 6 30745823 unclassified probably benign
R1768:Mest UTSW 6 30745139 missense probably benign 0.01
R1835:Mest UTSW 6 30742791 missense probably benign 0.14
R2131:Mest UTSW 6 30745885 missense probably damaging 1.00
R3918:Mest UTSW 6 30742750 missense probably benign 0.07
R3919:Mest UTSW 6 30742750 missense probably benign 0.07
R4544:Mest UTSW 6 30740680 missense probably damaging 1.00
R4546:Mest UTSW 6 30740680 missense probably damaging 1.00
R4647:Mest UTSW 6 30745110 nonsense probably null
R6818:Mest UTSW 6 30746287 missense probably damaging 1.00
R7048:Mest UTSW 6 30742724 missense probably damaging 1.00
R7158:Mest UTSW 6 30744914 missense possibly damaging 0.65
R7290:Mest UTSW 6 30747159 missense unknown
R7971:Mest UTSW 6 30740735 missense
Z1177:Mest UTSW 6 30723575 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGACTTGCTCTATAAAGCTCACC -3'
(R):5'- CACATGGAATGATGGCAGCC -3'

Sequencing Primer
(F):5'- ATAAAGCTCACCTAACAATAAGTGAG -3'
(R):5'- TGGCAGCCATGACAGTG -3'
Posted On2019-11-12