Mutagenetix > Incidental Mutation

Incidental Mutation 'R7734:Smarca4'

596057

Institutional Source

Beutler Lab

Gene Symbol

Smarca4

Ensembl Gene

ENSMUSG00000032187

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4

Synonyms

SNF2beta, SW1/SNF, b2b508.1Clo, Brg1, b2b692Clo

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7734 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

21616169-21704230 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 21667362 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 938 (T938I)

Ref Sequence

ENSEMBL: ENSMUSP00000096547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]

AlphaFold

Q3TKT4

Predicted Effect

probably damaging
Transcript: ENSMUST00000034707
AA Change: T938I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: T938I

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1360	1385	N/A	INTRINSIC
low complexity region	1388	1398	N/A	INTRINSIC
BROMO	1422	1533	4.19e-42	SMART
low complexity region	1534	1557	N/A	INTRINSIC
low complexity region	1578	1588	N/A	INTRINSIC
low complexity region	1594	1614	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098948
AA Change: T938I

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: T938I

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1363	1388	N/A	INTRINSIC
low complexity region	1391	1401	N/A	INTRINSIC
BROMO	1425	1536	4.19e-42	SMART
low complexity region	1537	1560	N/A	INTRINSIC
low complexity region	1581	1591	N/A	INTRINSIC
low complexity region	1597	1617	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000133535
Gene: ENSMUSG00000032187
AA Change: T742I

Domain	Start	End	E-Value	Type
low complexity region	26	52	N/A	INTRINSIC
low complexity region	57	94	N/A	INTRINSIC
low complexity region	109	135	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
HSA	265	337	2e-27	SMART
coiled coil region	367	399	N/A	INTRINSIC
BRK	417	461	5.17e-21	SMART
low complexity region	462	477	N/A	INTRINSIC
low complexity region	496	507	N/A	INTRINSIC
DEXDc	555	747	5.17e-38	SMART
Blast:DEXDc	758	790	6e-10	BLAST
low complexity region	824	839	N/A	INTRINSIC
HELICc	915	999	7.27e-24	SMART
low complexity region	1088	1105	N/A	INTRINSIC
SnAC	1126	1194	2.8e-29	SMART
low complexity region	1201	1226	N/A	INTRINSIC
low complexity region	1229	1239	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174008
AA Change: T938I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: T938I

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1360	1385	N/A	INTRINSIC
low complexity region	1388	1398	N/A	INTRINSIC
BROMO	1422	1532	1.36e-41	SMART
low complexity region	1533	1556	N/A	INTRINSIC
low complexity region	1577	1587	N/A	INTRINSIC
low complexity region	1593	1613	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	A	18: 12,189,263	I591N	possibly damaging	Het
Anxa2	T	C	9: 69,491,482	Y333H	probably benign	Het
Arid1a	A	T	4: 133,681,368	F1558I	unknown	Het
Aste1	A	G	9: 105,397,479	D306G	probably damaging	Het
Atp2a2	A	G	5: 122,458,527	V843A	possibly damaging	Het
Atrip	T	A	9: 109,065,506	H451L	probably benign	Het
Cdc42bpb	T	C	12: 111,329,230	D200G	probably damaging	Het
Ceacam19	A	C	7: 19,886,595	M37R	probably benign	Het
Cemip	G	A	7: 83,957,664	R782*	probably null	Het
Cpe	A	T	8: 64,617,620	I197N	probably benign	Het
Csmd2	C	A	4: 128,552,057	P3307T		Het
Cyp4a12b	C	A	4: 115,411,740	Q20K	possibly damaging	Het
Dcaf1	T	C	9: 106,838,679	Y332H	probably damaging	Het
Dclk3	A	G	9: 111,469,095	H569R	probably damaging	Het
Dcp1b	A	G	6: 119,215,283	S387G	probably benign	Het
Ddx24	A	G	12: 103,417,560	M590T	possibly damaging	Het
Dixdc1	T	G	9: 50,701,968	Q229P	probably damaging	Het
Dnase1l3	T	C	14: 7,977,144	R181G	probably benign	Het
Dzip1l	A	T	9: 99,667,682	D735V	probably damaging	Het
Edem3	T	C	1: 151,818,585	S890P	probably benign	Het
Fuom	A	G	7: 140,099,542	L155P	unknown	Het
Gm6408	C	A	5: 146,484,350	S263*	probably null	Het
Helz	C	G	11: 107,685,422	S1814R	unknown	Het
Hrc	T	C	7: 45,336,676	L417P	probably benign	Het
Igdcc4	A	C	9: 65,131,753	H894P	probably damaging	Het
Lgr6	C	A	1: 135,003,243	V296L	probably damaging	Het
Map3k4	T	A	17: 12,264,111	Y573F	probably damaging	Het
Mest	T	C	6: 30,746,300	Y296H	unknown	Het
Mettl21a	C	T	1: 64,608,129	V90M	probably damaging	Het
Mfsd4b1	A	T	10: 40,007,378	N25K	probably damaging	Het
Mmd	T	A	11: 90,276,753	F203I	probably damaging	Het
Myo15	G	A	11: 60,510,282	V3028M	probably benign	Het
Nlrp1a	T	A	11: 71,108,000	N859I	unknown	Het
Nrcam	T	C	12: 44,537,251	L36P	possibly damaging	Het
Nup107	C	A	10: 117,758,012	E759*	probably null	Het
Olfr305	A	G	7: 86,364,268	I23T	not run	Het
Pcdh7	T	G	5: 57,719,634	I177S	probably damaging	Het
Pde6a	T	C	18: 61,232,866	I221T	probably benign	Het
Ptpn13	A	T	5: 103,561,962	N1497I	probably damaging	Het
Rpl4	T	A	9: 64,177,379	H245Q	probably benign	Het
Rsf1	C	CCACGGCGGG	7: 97,579,908		probably benign	Het
Scara5	A	G	14: 65,731,151	D291G	possibly damaging	Het
Sept14	T	A	5: 129,683,519	I422L	probably benign	Het
Serpina1e	T	C	12: 103,950,892	K173E	probably benign	Het
Slc5a1	C	T	5: 33,160,935	T644I	probably benign	Het
Slc6a13	A	T	6: 121,337,375	T590S	probably benign	Het
Stxbp1	A	T	2: 32,801,820	D453E	probably benign	Het
Tcf12	C	A	9: 71,922,661	V173L	probably benign	Het
Tenm3	A	G	8: 48,646,333	C146R	probably damaging	Het
Trim11	T	C	11: 58,978,354	C39R	probably damaging	Het
Trim37	A	G	11: 87,177,995	Y389C	probably damaging	Het
Ttll8	C	T	15: 88,914,165	G789D	probably damaging	Het
Tubb2a	C	T	13: 34,074,793	S338N	probably benign	Het
Ulk2	G	A	11: 61,853,301	Q50*	probably null	Het
Urgcp	T	C	11: 5,716,406	D687G	probably benign	Het
Usp13	C	T	3: 32,837,905	H78Y	probably benign	Het
Vmn2r100	T	A	17: 19,522,034	D223E	probably benign	Het
Vwc2	G	A	11: 11,115,929	A6T	possibly damaging	Het

Other mutations in Smarca4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Smarca4	APN	9	21679073	missense	probably benign	0.30
IGL01694:Smarca4	APN	9	21665870	missense	probably damaging	1.00
IGL02147:Smarca4	APN	9	21635703	missense	probably damaging	0.98
IGL02417:Smarca4	APN	9	21701090	missense	probably damaging	1.00
IGL02421:Smarca4	APN	9	21639239	missense	probably damaging	1.00
IGL02550:Smarca4	APN	9	21686122	missense	probably benign	0.25
IGL02794:Smarca4	APN	9	21673342	splice site	probably benign
IGL03030:Smarca4	APN	9	21635836	missense	probably benign	0.14
IGL03037:Smarca4	APN	9	21632935	unclassified	probably benign
IGL03069:Smarca4	APN	9	21635836	missense	probably benign	0.14
IGL03355:Smarca4	APN	9	21635836	missense	probably benign	0.14
R0123:Smarca4	UTSW	9	21637324	missense	probably damaging	1.00
R0134:Smarca4	UTSW	9	21637324	missense	probably damaging	1.00
R0230:Smarca4	UTSW	9	21700872	missense	probably damaging	0.99
R0269:Smarca4	UTSW	9	21636201	missense	probably benign	0.09
R0631:Smarca4	UTSW	9	21658984	splice site	probably benign
R0665:Smarca4	UTSW	9	21700943	small deletion	probably benign
R0726:Smarca4	UTSW	9	21700139	critical splice donor site	probably null
R0801:Smarca4	UTSW	9	21642554	missense	possibly damaging	0.81
R0918:Smarca4	UTSW	9	21636215	missense	probably benign	0.16
R1411:Smarca4	UTSW	9	21658955	missense	probably damaging	1.00
R1604:Smarca4	UTSW	9	21700943	small deletion	probably benign
R1768:Smarca4	UTSW	9	21701183	missense	possibly damaging	0.56
R2004:Smarca4	UTSW	9	21677480	missense	probably damaging	1.00
R2031:Smarca4	UTSW	9	21686062	missense	possibly damaging	0.68
R2211:Smarca4	UTSW	9	21686029	missense	probably damaging	1.00
R2512:Smarca4	UTSW	9	21635698	missense	possibly damaging	0.95
R2875:Smarca4	UTSW	9	21642580	missense	possibly damaging	0.55
R3786:Smarca4	UTSW	9	21672059	missense	possibly damaging	0.94
R4829:Smarca4	UTSW	9	21639327	missense	probably damaging	0.97
R5084:Smarca4	UTSW	9	21660763	missense	probably damaging	1.00
R5222:Smarca4	UTSW	9	21655706	missense	probably benign	0.01
R5785:Smarca4	UTSW	9	21686026	missense	probably damaging	0.99
R5844:Smarca4	UTSW	9	21677942	intron	probably benign
R5964:Smarca4	UTSW	9	21647430	missense	probably benign	0.00
R6001:Smarca4	UTSW	9	21632909	unclassified	probably benign
R6072:Smarca4	UTSW	9	21700121	missense	probably damaging	1.00
R6254:Smarca4	UTSW	9	21699877	missense	probably damaging	1.00
R6320:Smarca4	UTSW	9	21637375	missense	probably damaging	1.00
R6353:Smarca4	UTSW	9	21679149	critical splice donor site	probably null
R6461:Smarca4	UTSW	9	21679020	missense	probably damaging	1.00
R6886:Smarca4	UTSW	9	21658831	missense	probably damaging	1.00
R7098:Smarca4	UTSW	9	21634820	missense	probably benign	0.10
R7253:Smarca4	UTSW	9	21658960	missense	probably benign	0.01
R7307:Smarca4	UTSW	9	21638800	missense	probably damaging	1.00
R7382:Smarca4	UTSW	9	21658933	missense	probably damaging	0.98
R7445:Smarca4	UTSW	9	21686247	missense	probably damaging	1.00
R7535:Smarca4	UTSW	9	21647625	missense	possibly damaging	0.82
R7573:Smarca4	UTSW	9	21639075	splice site	probably null
R7644:Smarca4	UTSW	9	21655654	missense	probably benign	0.00
R7833:Smarca4	UTSW	9	21647359	missense	possibly damaging	0.86
R8085:Smarca4	UTSW	9	21658812	splice site	probably null
R8119:Smarca4	UTSW	9	21647626	missense	possibly damaging	0.61
R8320:Smarca4	UTSW	9	21677502	missense	probably benign	0.10
R8445:Smarca4	UTSW	9	21700943	small deletion	probably benign
R8493:Smarca4	UTSW	9	21658848	missense	probably damaging	1.00
R8748:Smarca4	UTSW	9	21634868	missense	possibly damaging	0.85
R8788:Smarca4	UTSW	9	21638728	missense	probably damaging	1.00
R8817:Smarca4	UTSW	9	21636201	missense	probably benign	0.04
R9241:Smarca4	UTSW	9	21639308	missense	possibly damaging	0.72
R9446:Smarca4	UTSW	9	21635859	missense	unknown
R9570:Smarca4	UTSW	9	21669553	missense	probably damaging	1.00
R9727:Smarca4	UTSW	9	21699864	missense	probably damaging	1.00
R9801:Smarca4	UTSW	9	21675101	missense	probably damaging	1.00
Z1176:Smarca4	UTSW	9	21702957	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CGCTGGAAGTACATGATTGTG -3'
(R):5'- GGGACATCTGTTTTCTGCCC -3'

Sequencing Primer
(F):5'- TACATGATTGTGGATGAAGGCC -3'
(R):5'- CTGCCCTGCTGAAGTCTTGG -3'

Posted On

2019-11-12