Incidental Mutation 'R7734:Rpl4'
ID596059
Institutional Source Beutler Lab
Gene Symbol Rpl4
Ensembl Gene ENSMUSG00000032399
Gene Nameribosomal protein L4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R7734 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location64173375-64178666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64177379 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 245 (H245Q)
Ref Sequence ENSEMBL: ENSMUSP00000034966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034965] [ENSMUST00000034966] [ENSMUST00000122091] [ENSMUST00000130127] [ENSMUST00000176299] [ENSMUST00000176378] [ENSMUST00000176794] [ENSMUST00000177045]
Predicted Effect probably benign
Transcript: ENSMUST00000034965
SMART Domains Protein: ENSMUSP00000034965
Gene: ENSMUSG00000032398

DomainStartEndE-ValueType
Pfam:SNAPc19 7 101 5.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034966
AA Change: H245Q

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034966
Gene: ENSMUSG00000032399
AA Change: H245Q

DomainStartEndE-ValueType
Pfam:Ribosomal_L4 22 263 9.7e-47 PFAM
Pfam:Ribos_L4_asso_C 275 349 4e-34 PFAM
low complexity region 352 367 N/A INTRINSIC
low complexity region 375 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122091
SMART Domains Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 589 6e-206 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124301
SMART Domains Protein: ENSMUSP00000134966
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 3e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000130127
SMART Domains Protein: ENSMUSP00000116187
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 72 154 8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176299
SMART Domains Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 1 471 2.9e-192 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176378
SMART Domains Protein: ENSMUSP00000134782
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 1e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176794
SMART Domains Protein: ENSMUSP00000134850
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 257 8e-67 PFAM
Pfam:DUF2352 254 568 4.4e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177045
SMART Domains Protein: ENSMUSP00000135328
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 19 303 2.2e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L4E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T A 18: 12,189,263 I591N possibly damaging Het
Anxa2 T C 9: 69,491,482 Y333H probably benign Het
Arid1a A T 4: 133,681,368 F1558I unknown Het
Aste1 A G 9: 105,397,479 D306G probably damaging Het
Atp2a2 A G 5: 122,458,527 V843A possibly damaging Het
Atrip T A 9: 109,065,506 H451L probably benign Het
Cdc42bpb T C 12: 111,329,230 D200G probably damaging Het
Ceacam19 A C 7: 19,886,595 M37R probably benign Het
Cemip G A 7: 83,957,664 R782* probably null Het
Cpe A T 8: 64,617,620 I197N probably benign Het
Csmd2 C A 4: 128,552,057 P3307T Het
Cyp4a12b C A 4: 115,411,740 Q20K possibly damaging Het
Dcaf1 T C 9: 106,838,679 Y332H probably damaging Het
Dclk3 A G 9: 111,469,095 H569R probably damaging Het
Dcp1b A G 6: 119,215,283 S387G probably benign Het
Ddx24 A G 12: 103,417,560 M590T possibly damaging Het
Dixdc1 T G 9: 50,701,968 Q229P probably damaging Het
Dnase1l3 T C 14: 7,977,144 R181G probably benign Het
Dzip1l A T 9: 99,667,682 D735V probably damaging Het
Edem3 T C 1: 151,818,585 S890P probably benign Het
Fuom A G 7: 140,099,542 L155P unknown Het
Gm6408 C A 5: 146,484,350 S263* probably null Het
Helz C G 11: 107,685,422 S1814R unknown Het
Hrc T C 7: 45,336,676 L417P probably benign Het
Igdcc4 A C 9: 65,131,753 H894P probably damaging Het
Lgr6 C A 1: 135,003,243 V296L probably damaging Het
Map3k4 T A 17: 12,264,111 Y573F probably damaging Het
Mest T C 6: 30,746,300 Y296H unknown Het
Mettl21a C T 1: 64,608,129 V90M probably damaging Het
Mfsd4b1 A T 10: 40,007,378 N25K probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Myo15 G A 11: 60,510,282 V3028M probably benign Het
Nlrp1a T A 11: 71,108,000 N859I unknown Het
Nrcam T C 12: 44,537,251 L36P possibly damaging Het
Nup107 C A 10: 117,758,012 E759* probably null Het
Olfr305 A G 7: 86,364,268 I23T not run Het
Pcdh7 T G 5: 57,719,634 I177S probably damaging Het
Pde6a T C 18: 61,232,866 I221T probably benign Het
Ptpn13 A T 5: 103,561,962 N1497I probably damaging Het
Rsf1 C CCACGGCGGG 7: 97,579,908 probably benign Het
Scara5 A G 14: 65,731,151 D291G possibly damaging Het
Sept14 T A 5: 129,683,519 I422L probably benign Het
Serpina1e T C 12: 103,950,892 K173E probably benign Het
Slc5a1 C T 5: 33,160,935 T644I probably benign Het
Slc6a13 A T 6: 121,337,375 T590S probably benign Het
Smarca4 C T 9: 21,667,362 T938I possibly damaging Het
Stxbp1 A T 2: 32,801,820 D453E probably benign Het
Tcf12 C A 9: 71,922,661 V173L probably benign Het
Tenm3 A G 8: 48,646,333 C146R probably damaging Het
Trim11 T C 11: 58,978,354 C39R probably damaging Het
Trim37 A G 11: 87,177,995 Y389C probably damaging Het
Ttll8 C T 15: 88,914,165 G789D probably damaging Het
Tubb2a C T 13: 34,074,793 S338N probably benign Het
Ulk2 G A 11: 61,853,301 Q50* probably null Het
Urgcp T C 11: 5,716,406 D687G probably benign Het
Usp13 C T 3: 32,837,905 H78Y probably benign Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Vwc2 G A 11: 11,115,929 A6T possibly damaging Het
Other mutations in Rpl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Rpl4 APN 9 64174939 missense probably damaging 1.00
IGL02142:Rpl4 APN 9 64176206 missense possibly damaging 0.86
IGL02746:Rpl4 APN 9 64175650 missense probably benign 0.00
IGL03084:Rpl4 APN 9 64178317 unclassified probably benign
IGL03332:Rpl4 APN 9 64176088 unclassified probably benign
R2320:Rpl4 UTSW 9 64175599 missense probably damaging 1.00
R4990:Rpl4 UTSW 9 64174885 missense probably benign 0.15
R6880:Rpl4 UTSW 9 64177053 missense probably damaging 1.00
R7985:Rpl4 UTSW 9 64177930 missense probably damaging 1.00
R8754:Rpl4 UTSW 9 64174960 missense probably damaging 1.00
R8941:Rpl4 UTSW 9 64174963 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAAGTTCTGAGTCCTACGTGAG -3'
(R):5'- GGTGAGGCACATCCAAACAATG -3'

Sequencing Primer
(F):5'- ACGTGAGTGAGCTACGCCAG -3'
(R):5'- ACGCAAACAAAATGTGAATGC -3'
Posted On2019-11-12